Professional Documents
Culture Documents
An Endophytic Nodulisporium sp. Producing Volatile Organic Compounds Having Bioactivity and Fuel Potential
Endophytic microorganism are found in nature as they occupy the interstitial places of plant tissues and cause no apparent symptoms of their presence in the plant. The relation between microbe and plant can vary from symbiotic to borderline pathogenic. When the endophytic microorganism needs nutritive sources, the host plant offer it. Its contribution, may be one of the tissue protection generated of its own anti-pest metabolites. In fact, a lot of antibiotics have been isolated from various endophytic microbes. To date, the new endophytic fungus have been described as Muscodor sp. The search has been broadened to include many endophytic microorganism that may have potential to become biological control agent and potential fuel producers. The interest is, without the spectrum of volatile compound which made from each endophytic is to find one or more volatile compound that associate with the major classes of volatiles that are present in petroleum distillate fuels. These include the linear and branched chained alkanes. Thus, this report discuss about an endophytic fungus that produces highly desirable volatile metabolites. The endophytic fungus described in this report is Nodulisporium sp. having the most likely perfect stage being Daldinia eschscholzii (EC-12). A search for a new endophytic that produce VOC was conducted in the Napo river region of the upper Amazon in Ecuador. At least 20 plants were obtained by clipping terminal stem pieces from readily accessible portions of sample trees. The harvested specimens weere kept cool and the stem were treated and internal tissues pieces were set out on plates of water agar (WA) and glycerol-arginine medium (GAM). The tissue pieces were incubated at room temperature for several days. Visible fungal growth from the tissue samples were picked as hyphal tips and sub-cultured and transferred to potato dextrose agar (PDA) plates. An endophyte of interest was designated EC-12. The morphological data from EC-12 was acquired from Scanning Electron Microscopy process. The fungus was grown on -irradiated carnation leaves for 3 weeks and then the samples were slowly dehidrated in ethanol. The analysis of EC-12 was carried out by the acquisition of the ITS (Internal Transcribed Spacer)-5.8 S ribosomal gene scene. ITS regions of the fungus were amplified with the universal ITS primers ITS1 (5 TCCGTAGGTGAACCTGCGG 3) and ITS4 (5 TCCTCCGCTTATTGATATGC 3) using the polymerase chain reaction (PCR) that have been processed. Furthermore, the amplified product, was visualized and sequenced. To obtain the quantitative weight measurements on the VOC and also to learn what VOCs are made under conditions of near optimum aeration, the endophytes was grown in 7L of PD broth in a 10L flask for 14days at 22C. The flask outlet was connected to a custom designed stainless steel column containing Carbotrap materials specifically designed for trapping hydrocarbons aandd hydrocarbon derivatives. The compounds in the carbotrap column were desorbed by heating in a programmable oven, purged with a flow nitrogen gas, followed by passage of the effluent in a tube cooled with liquid nitrogen. From the process, the efficiency of the column trapping method ranges from 65-70% efficient.
Izza Cahya Kamila 125061100111027 Chemical Engineering A 2012 The volatiles produced by 13 days old culture of EC-12 were tested for antimicrobial activity against selected pathogenic fungi. The assays were conducted by growing the test organism on half side of a petri plate and then placing a small plug of each test fungus on the another side of the plate. Then the plate wrapped with parafilm and incubated at 23C for varying time periods. Growth of the filamentous test fungi was quantitatively assessed by making multiple measurements of growth. On the other hand, the carbotrapped VOCs were found in the trapping tube and assayed according to the methods described by Strobel. The test mixture is transferred to a small plastic cup and placed in the center of a Petri plate surrounded by small plugs of test organism. The growth of the test organism measured after appropriate exposure times. To determine the composition of VOCs, the fungus was grown in 60 ml of PD broth for 7 days in a sealed 250 ml Erlenmeyer flask, with constant agitation at 22C. Gas analysis of the compounds desorbed from the stainless steel Carbotrap (trapping tube) was done on a preconditioned fiber for 5 min after the tube was gently warmed to a volatilize the trapped liquid. The endophytic organism EC-12, by light and scanning electron microscopy produced an imperfect stage resembling that of Nodulisporium sp. (Figure 1). The organism when grown on PDA (2 week old culture) produced whitish felt-like mycelia on the 4 cm perphery of the culture. The mycelium produced erect to suberect, branching conidiophores with slender conidiogenous cells attached in irregular to verticillate patterns. Evidence of successional budding was seen as bud scars on conidiogenous cells (Figure 1). In all respects the fungus totally resembled Nodulisporium sp. However, the18S-ITS5.8S of the organism showed 99% sequence similarity with Daldinia escholzii which is the most likely the perfect stage for this organism even though it was never observed and D. escholzii has Nodulisporium sp. as its imperfect stage (Figure 2).
The potential fuel compounds that could be consistently matched, in repeated experiments and on a qualitative basis, were 1,4-cyclohexadiene, 1-methyl-, 1-4 pentadiene and cyclohexene, 1-methyl-4-(1-methylethenyl)-, but other volatile compounds of interest were also produced (Table 1 in the journal). Interestingly, the cyclohexanes as well as pentane and its derivatives constitute some of the major groups of hydrocarbons in diesel fuels as analyzed by the SPME technique (Strobel, unpublished). However, the compounds in greatest abundance in the fungal VOCs were 1-butanol-3 methyl (and or 1 pentanol), and phenylethyl alcohol which also have fuel potential (Table 1 in the journal). Also, present in the analysis were a series of terpenoids including naphthene and azulene derivatives (Table 1 in the journal). In the other hands, the SPME-GC/MS analysis of the VOCs trapped by the Carbotraps yielded a plethora of hydrocarbon derivatives (as we see on Table 2 in the journal). Again, the most abundant substances detected were phenylethyl alcohol and 1-butanol-3-methyl which is comparable to that found in the smaller flasks (Table 2 in the journal). Also, it appears that the most, but not all of the compounds present in the trapping tube could detected and identified by this method (Table 2 in the journal). Andd since Nodulisporium sp. was making a plethora of VOCs it was deemed important to determine the biological role of these gases. A simple split plate test was done on 13 day old cultures of Nodulisporium sp. The results showed that the VOCs of the fungus were active against a wide range of plant pathogenic fungi (Table 3 in the journal). This is probably the case since many of the VOCs reported for M.albus are not present in Nodulisporium sp. and vice versa (Tables 1 and 2 in the journal). Finally, since the VOCs of Nodulisporium sp. could be recovered by the Carbotrap technology, they too were subjected to a bioassay test utilizing several select plant pathogens (Table 4 in the journal) and we have to know that the biological activity of the VOCs of this fungus is quite interesting given the fact that it express so much selectively. It would appear that this kind of testing should be done in future studies involving fungi making biologically active VOCs.