CA2720546A1 - Substituted 1,3-cyclopentadione attenuated endothelial inflammation and endothelial-monocyte interactions - Google Patents

Abstract

Compositions and methods for reducing cardiovascular risk utilizing substituted 1,3- cyclopentadione compounds are described.

Description

SUBSTITUTED 1,3-CYCLOPENTADIONE ATTENUATED ENDOTHELIAL
INFLAMMATION AND ENDOTHELIAL - MONOCYTE INTERACTIONS
CROSS-REFERENCE TO RELATED APPLICATIONS

[001] This patent application claims priority to U.S. provisional application Ser. No.
61/041,631 filed on April 2, 2008, the contents of which are incorporated herein in its entirety by reference.

BACKGROUND OF THE INVENTION

[002] Field of the Invention [003] The present invention relates generally to methods and compositions that can be used to modulate inflammatory pathways associated with endothelial function and cardiovascular complications, including (1) TNFa mediated VCAM-1, E selectin and MCP-1 in endothelial cells (HAEC) and (2) TNFa mediated Monocyte-Endothelial interactions via protein kinase modulation.
More specifically, the invention relates to methods and compositions that utilize substituted 1,3-cyclopentadione compounds.

[004] Description of the Related Art [005] Monocyte activation and adhesion to the endothelium play critical roles in inflammatory and cardiovascular diseases. The process is further complicated by hyperglycemia leading to the complications in diabetes. Both TNFa and hyperglycemia activate many genes involved in the inflammatory responses (Shanmugam N, Gae Gonzalo IT, Natarajan R. Molecular mechanisms of high glucose-induced cyclooxygenase-2 expression in monocytes.
Diabetes.
53(3):795-802, 2004.).

[006] MCP-1 is a potent chemoattractant for monocytes and plays pivotal role in early atherogenesis by promoting monocyte infiltration and adherence to the endothelium, leading to the formation atherosclerotic plaque (Charo IF, Taubman MB. Chemokines in the pathogenesis of vascular disease. Circ Res. 29;95(9):858-66, 2004.).

[007] Matrix metalloproteinases (MMPs) are the primary proteolytic enzymes in the extracellular space, contributing to weakening of the plaque cap via their ability to cleave the extracellular matrix (ECM) (Nagase H, Visse R, Murphy G. Structure and function of matrix metalloproteinases and TIMPs. Cardiovasc Res 2006;69:562-73.). Atherosclerotic plaque rupture, causally related to the majority of acute coronary syndromes, commonly occurs at sites of continuous inflammation and collagen degradation (Virmani R, Kolodgie FD, Burke AP, Farb A, Schwartz SM. Lessons from sudden coronary death: a comprehensive morphological classification scheme for atherosclerotic lesions. Arterioscler Thromb Vasc Biol 2000;20:1262-75.).

[008] Clinical and experimental studies have implicated MMP-9 (gelatinase B) as a key determinant of atherosclerotic plaque stability (Gough PJ, Gomez IG, Wille PT, Raines EW.
Macrophage expression of active MMP-9 induces acute plaque disruption in apoE-deficient mice. J
Clin Invest 2006;116:59-69.; Fukuda D, Shimada K, Tanaka A, Kusuyama T, Yamashita H, Ehara S, et al. Comparison of levels of serum matrix metalloproteinase-9 in patients with acute myocardial infarction versus unstable angina pectoris versus stable angina pectoris. Am J
Cardiol 2006;97:175-80. ; Blankenberg S, Rupprecht HJ, Poirier 0, Bickel C, Smieja M, Hafner G, et al. Plasma concentrations and genetic variation of matrix metalloproteinase 9 and prognosis of patients with cardiovascular disease. Circulation 2003;107:1579-85.). MMP-9 principally derives from monocytes/ macrophages (Chase AJ, Bond M, Crook MF, Newby AC. Role of nuclear factor kappa B activation in metalloproteinase-1, -3, and -9 secretion by human macrophages in vitro and rabbit foam cells produced in vivo. Arterioscler Thromb Vasc Biol 2002;22:765-71.;
Stawowy P, Meyborg H, Stibenz D, Borges Pereira Stawowy N, Roser M, Thanabalasingam U, et al. Furin-like proprotein convertases are central regulators of the membrane type matrix metalloproteinase-promatrix metalloproteinase-2 proteolytic cascade in atherosclerosis.
Circulation 2005;111:2820-7.), the major cell type involved in the initiation, progression and complications of atherosclerosis.
In MNCs MMP- 9 is strongly inducible by a number of inflammatory mediators, including TNF-a (Stawowy P, Meyborg H, Stibenz D, Borges Pereira Stawowy N, Roser M, Thanabalasingam U, et al. Furin-like proprotein convertases are central regulators of the membrane type matrix metalloproteinase-promatrix metalloproteinase-2 proteolytic cascade in atherosclerosis. Circulation 2005; 111:2820-7.).

[009] It has previously been shown that the anti-inflammatory compounds such as aspirin, glucocorticoids, and curcumin exert their effects through the inhibition of NF-xB signaling pathways (Kopp E and Ghosh S. Inhibition of NF-kappa B by sodium salicylate and aspirin.
Science. 22: 270 (5244): 2017-9,1994.; De Bosscher K, Schmitz ML, Vanden Berghe W, Plaisance S, Fiers W, Haegeman G. Glucocorticoid-mediated repression of nuclear factor-kappaB-dependent transcription involves direct interference with transactivation. Proc Natl Acad Sci U S A.
9;94(25):13504-9, 1997.; Pan MH, Lin-Shiau SY, Ho CT, Lin JH, Lin JK.
Suppression of lipopolysaccharide-induced nuclear factor-kappaB activity by theaflavin-3,3'-digallate from black tea and other polyphenols through down-regulation of IkappaB kinase activity in macrophages.
Biochem Pharmacol. 15;59(4):357-67, 2000.).

[0010] Inflammatory mediators, such as TNFa activate NFkB, which regulate the expression of many genes involved in the inflammatory responses such as proinflammatory cytokines, adhesion molecules, chemokines including monocyte chemotactic protein-1 (MCP-1) (Ueda A, Ishigatsubo Y, Okubo T, Yoshimura T. Transcriptional regulation of the human monocyte chemoattractant protein-1 gene. Cooperation of two NF-kappaB sites and NF-kappaB/Rel subunit specificity. J Biol Chem. 5;272(49):31092-9, 1997.). It has been shown that hyperglycemia activate inflammation through the activation of PKC and NF-kB signaling pathways in monocytes (Devaraj S, Venugopal SK, Singh U, Jialal I. Hyperglycemia induces monocytic release of interleukin-6 via induction of protein kinase c-{ alpha} and -{ beta]. Diabetes.; 54(1):85-91, 2005.; Shanmugam N, Gae Gonzalo IT, Natarajan R. Molecular mechanisms of high glucose-induced cyclooxygenase-2 expression in monocytes. Diabetes. 53(3):795-802, 2004.) [0011] Reversible phosphorylation of proteins regulates nearly all aspects of cell physiology. Chronic dysregulation of specific kinases and phosphatases exert their effects by altering the normal phosphorylation state of intracellular proteins, giving rise to a number of disorders including cancers and inflammatory diseases. Hence, protein kinases are a major therapeutic target.

[0012] The over-activation of specific kinases is particularly associated with many diseases and as expected, certain, targeted kinase inhibitors have been shown to be efficacious in normalizing cellular physiology and bringing about remission. For example, imatinib (tyrosine kinase inhibitor) is effective in the treatment of leukemia [Savage DG, N Eng J Med 2002];
erlotinib (Epidermal Growth Factor Receptor inhibitor) for lung cancer (Reviewed in Expert Opin Pharmacother, Gridelli, 2007); and ruboxistaurin (PKC-beta II inhibitor) for reducing microvascular complications for diabetic patients (Joy SV, et al. Ruboxistaurin, a protein kinase C beta inhibitor, as an emerging treatment for diabetes microvascular complications. Ann Pharmacother. 39(10):
1693-9, 2005).

[0013] Endothelial derived Nitric Oxide (NO) is a key determinant of cardiovascular homeostasis modulating vascular endothelial responsiveness and thus regulating systemic blood pressure, vascular remodeling and angiogenesis (Moncada S, Higgs A: The L-Arginine-Nitric Oxide pathway. NEJM 1993;329:2002-12). An important stimulus for the continuous production of NO is viscous drag related to blood flow across the endothelium.
Endothelial NO synthase (eNOS) is under direct regulation by the protein kinase Akt. Shear stress and hyperglycemia through a series of mediating kinases directly activation Akt. (Dimmeler S, Fleming I, Fisslthaler B, Hermann C, Busse R, Zeiher AM. Activation of nitric oxide synthase in endothelial cells by Akt-dependent phosphorylation. Nature 1999;399:601-5). One of these kinases which actually inhibit Akt is PKC(3. PKC(3 is activated by hyperglycemia. Hyperglycemia has been directly shown to inhibit endothelial dependent vasodilation (Rammos G, Peppes V, Zakopoulos N.
Transient Insulin Resistance in Normal Subjects: Acute Hyperglycemia inhibits Endothelial-Dependent Vasodilation in Normal Subjects. Metabolic Syndrome and Related Disorders 2008;6(3):159-170.).
Roboxistaurin inhibits PKC(3 and thus normalizes endothelial function as measured by Flow Mediated Vasodilation (FMD) (Mehta NN, Sheetz M, Price K, Comiskey L, Amrutia S, Iqbal N, Mohler ER, Reilly MP. Selective PKC beta inhibition with roboxistaurin and endothelial function in type-2 diabetes mellitus. Cardiovasc Drugs Ther 2009;23(1):17-24). FMD is a non-invasive ultrasonographic technique for measuring brachial artery flow physiology after an induced hypoxemia (Corretti MC et al. Guidelines for the Ultrasound Assessment of Endothelial-Dependent Flow-Mediated Vasodilation of the Brachial Artery - A Report of the International Brachial Artery Reactive Task Force. J Am Coll Cardiol 2002; 39(2): 257-65).

[0014] Previously, we reported that several compounds derived from hop cones, including humulones, lupulones, isohumulones, and reduced isohumulones (modified hop extract used as flavorings) potently inhibit lipopolysaccharide (LPS) stimulated PGE2 formation in RAW 264.7 cells (Tripp M, Darland G, Lerman R, Lukaczer D, Bland J, Babish J: Hop and modified hop extracts have potent in vitro anti-inflammatory properties. Acta Hort (ISHS) 2005, 668:217-228).
Among the most active are the substituted 1,3-cyclopentadione compounds derived from hops are the tetrahydro-isoalpha acids, collectively denoted herein as denoted Meta-060 or "THIAA. Meta-060 is a modified hop extract comprised of a mixture of three related analogs, tetrahydro-iso -humulone, -cohumulone, and -adhumulone at a ratio of 49:42:9. META-060 inhibits LPS induced PGE2 production and COX-2 expression by inhibiting the NFkB signaling pathway in RAW 264.7 cells (Desai A, Konda VR, Darland G, Austin M, Prabhu KS, Bland JS, et al.
META060 inhibits multiple kinases in the NF-kB pathway and suppresses LPS - mediated inflammation in vitro and ex vivo. Inflamm Res 2009).

[0015] Macrophage/monocyte activation participates pivotally in the pathophysiology of many chronic inflammatory diseases. The role of inflammation at all stages of the atherosclerotic process has become an active area of investigation, and there is a need for novel and innovative therapeutics to treat atherosclerosis. As such, the inventors have ascertained the inhibitory effects of Meta-060 on the NFkB pathway acting via kinase inhibition against key kinases involved in NFkB
activation. Further, to assess specificity, the efficacy of META-060 was assessed against 85 different kinases.

[0016] Additionally, the inventors report on META-060's ability to inhibit other inflammatory markers under NFkB regulation and associated with cardiovascular complications, including (1). TNFa mediated VCAM-1, E selectin and MCP-1 in endothelial cells (HAEC) and (2).
TNFa mediated Monocyte-Endothelial interactions.

SUMMARY OF THE INVENTION

[0017] The present invention relates generally to methods and compositions that can be used to modulate inflammatory pathways associated with endothelial function and cardiovascular complications, including (1) TNFa mediated VCAM-1, E selectin and MCP-1 in endothelial cells (HAEC) and (2) TNFa mediated Monocyte-Endothelial interactions via protein kinase modulation.
More specifically, the invention relates to methods and compositions that utilize substituted 1,3-cyclopentadione compounds.

[0018] A first embodiment of the invention describes methods for improving a cardiovascular risk factor in a subject in need. The methods comprise treating the subject with a therapeutically effective amount of a substituted 1,3-cyclopentadione compound where said amount modulates the expression of cardiovascular risk factor associated marker gene expression.

[0019] A second embodiment of the invention describes methods for promoting vascular elasticity in a subject in need, where the method comprises treating the subject with a therapeutically effective amount of a substituted 1,3-cyclopentadione compound where said amount increases vascular elasticity or dilation.

[0020] A third embodiment of the invention describes compositions promoting cardiovascular health in a subject. In this embodiment the compositions comprise a therapeutically effective amount of a substituted 1,3-cyclopentadione compound wherein such amount (a) modulates the expression of cardiovascular risk associated marker gene expression; or (b) increases vascular elasticity or dilation.

BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 graphically depicts the effects of substituted 1,3-cyclopentadione compound s on kinase activity y for kinases regulating inflammation and provides a showing of the specificity of the substituted 1,3-cyclopentadione compounds via Gini coefficient expression.

[0022] Figure 2 graphically depicts the effects of substituted 1,3-cyclopentadione compounds on the inhibition of selected endothelial inflammatory biomarkers.

[0023] Figure 3 graphically depicts the inhibitory effects of substituted 1,3-cyclopentadione compounds on endothelial-monocyte interactions.

[0024] Figure 4 depicts META-060 inhibition of THP-1 cell interactions to HAEC
cells.

[0025] Figure 5 depicts META-060 inhibition of MCP-1 expression in THP-1 cells.

[0026] Figure 6 displays the inhibitory effect of META-060 on TNFa and LPS
mediated MMP-9 levels in THP-1 cells. Panels A & B depict the respective effects of TNFa and LPS on MMP-9 levels while Panel C provides a zymograph displaying the effects on MMP-9 expression.

[0027] Figure 7 graphically displays the inhibitory effects of META-060 on LPS
mediated NFkB binding in THP-1 cells.

[0028] Figure 8 displays the inhibitory effects of META-060 on TNFa activated genes in THP-1 cells.

DETAILED DESCRIPTION OF THE INVENTION

[0029] The present invention relates generally to methods and compositions that can be used to modulate inflammatory pathways associated with endothelial function and cardiovascular complications, including (1) TNFa mediated VCAM-1, E selectin and MCP-1 in endothelial cells (HAEC) and (2) TNFa mediated Monocyte-Endothelial interactions via protein kinase modulation.
More specifically, the invention relates to methods and compositions that utilize substituted 1,3-cyclopentadione compounds.

[0030] The patents, published applications, and scientific literature referred to herein establish the knowledge of those with skill in the art and are hereby incorporated by reference in their entirety to the same extent as if each was specifically and individually indicated to be incorporated by reference. Any conflict between any reference cited herein and the specific teachings of this specification shall be resolved in favor of the latter.
Likewise, any conflict between an art-understood definition of a word or phrase and a definition of the word or phrase as specifically taught in this specification shall be resolved in favor of the latter.

[0031] Technical and scientific terms used herein have the meaning commonly understood by one of skill in the art to which the present invention pertains, unless otherwise defined.
Reference is made herein to various methodologies and materials known to those of skill in the art.
Standard reference works setting forth the general principles of recombinant DNA technology include Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, New York (1989); Kaufman et al., Eds., Handbook of Molecular and Cellular Methods in Biology in Medicine, CRC Press, Boca Raton (1995); McPherson, Ed., Directed Mutagenesis: A Practical Approach, IRL Press, Oxford (1991). Standard reference works setting forth the general principles of pharmacology include Goodman and Gilman's The Pharmacological Basis of Therapeutics, 11th Ed., McGraw Hill Companies Inc., New York (2006).

[0032] In the specification and the appended claims, the singular forms include plural referents unless the context clearly dictates otherwise. As used in this specification, the singular forms "a," "an" and "the" specifically also encompass the plural forms of the terms to which they refer, unless the content clearly dictates otherwise. Additionally, as used herein, unless specifically indicated otherwise, the word "or" is used in the "inclusive" sense of "and/or" and not the "exclusive" sense of "either/or." The term "about" is used herein to mean approximately, in the region of, roughly, or around. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth.
In general, the term "about" is used herein to modify a numerical value above and below the stated value by a variance of 20%.

[0033] As used herein, the recitation of a numerical range for a variable is intended to convey that the invention may be practiced with the variable equal to any of the values within that range. Thus, for a variable that is inherently discrete, the variable can be equal to any integer value of the numerical range, including the end-points of the range. Similarly, for a variable that is inherently continuous, the variable can be equal to any real value of the numerical range, including the end-points of the range. As an example, a variable that is described as having values between 0 and 2, can be 0, 1 or 2 for variables that are inherently discrete, and can be 0.0, 0.1, 0.01, 0.001, or any other real value for variables that are inherently continuous.

[0034] Reference is made hereinafter in detail to specific embodiments of the invention.
While the invention will be described in conjunction with these specific embodiments, it will be understood that it is not intended to limit the invention to such specific embodiments. On the contrary, it is intended to cover alternatives, modifications, and equivalents as may be included within the spirit and scope of the invention as defined by the appended claims. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. The present invention may be practiced without some or all of these specific details. In other instances, well known process operations have not been described in detail, in order not to unnecessarily obscure the present invention.

[0035] Any suitable materials and/or methods known to those of skill can be utilized in carrying out the present invention. However, preferred materials and methods are described.
Materials, reagents and the like to which reference are made in the following description and examples are obtainable from commercial sources, unless otherwise noted.

[0036] A first embodiment of the invention describes methods for improving a cardiovascular risk factor in a subject in need. The methods comprise treating the subject with a therapeutically effective amount of a substituted 1,3-cyclopentadione compound where said amount modulates the expression of cardiovascular risk factor associated marker gene expression.

[0037] In some aspects of this embodiment, the substituted 1,3-cyclopentadione compound is selected from the group comprising (+)-(4R,5S)-3,4-dihydroxy-2-(3-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-l-one, (-)-(4S,5S)-3,4-dihydroxy-2-(3-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-l-one, (+)-(4R,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-(3-methylpropanoyl)cyclopent-2-en-l-one, (-)-(4S,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-(3-methylpropanoyl)cyclopent-2-en-l-one, (+)-(4R,5S)-3,4-dihydroxy-2-(2-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-l-one and (+)-(4R,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-petanoylcyclopent-2-en-l-one.

[0038] In other aspects the cardiovascular risk associated marker gene being modulated is selected from the group consisting of TNFa, MCP-1, VCAM-1, MMP-3, ICAM1 and SDF1.

[0039] In yet other aspects, the method further comprises lifestyle modification or pharmaceutical treatment wherein the lifestyle modification or pharmaceutical treatment is selected from the group consisting of blood pressure reduction, cholesterol level modulation, diabetes treatment, increased exercise, inflammation, obesity and weight reduction, prothrombotic factors treatment, reduction in serum homocysteine and lipoprotein (a), serum triglyceride reduction, smoking cessation, and stress reduction.

[0040] As used herein, "improving a cardiovascular risk factor" means stabilizing, reducing or eliminating an identified cardiovascular risk factor thereby promoting improved cardiovascular health. Representative, non-limiting examples of cardiovascular risk factors include tobacco usage, elevated blood pressure, elevated serum total (and LDL) cholesterol, diabetes, advancing age, obesity, physical inactivity, family history of premature cardiac heart disease, elevated serum triglycerides, small LDL particles, elevated serum homocysteine or lipoprotein (a), prothrombotic factors (e.g., fibrinogen), and inflammatory factors (e.g., C-reactive protein).

[0041] The phrase "modulates the expression of cardiovascular risk factor associated marker gene expression" means the up or down regulation of the expression of the gene, or it's associated gene product production or activity. Non-limiting representative examples of genes identified or associated with various aspects of cardiovascular risk factors include AQP1, B3GAT3, BCL3, BTG2, C1ORF106, C1ORF38, C1ORF38, CACNAIA, CCDC75, CCL2, CCL8, CCND1, CD40, CD44, CD86, CLIP2, DDX58, DKFZP434H1419, DSC3, EHD1, EIF2AK2, FAM105A, FGD2, FKBP5, G3BP1, GPR153, HTR4, ICAM1, ICOSLG, IFI44, IFI44L, IFIH1, IFIT1, IFIT2, IFIT3, IGKC, IGKV1-5, IKBKE, IKZF1, ILIORA, IL18RAP, IL1B, IL7R, IRF7, ISG15, KIAA1731, KRT17, LHX, LIMD2, LTB, MARCKSLI, MCP-1, MMP3, MMP14, MMP9, MX1, MX2, NA, NAB1, NAB2, NOD2, NPTX1, OAS1, OAS2, OAS3, OASL, PDE4B, PIPSKIB, PRKCH, PTGIR, PTPN14, RASA, RASA4, RASSF4, REC8, RIN3, RSAD2, SAFB2, SAMD9, SDF1, SEMA4C, SH3TC1, SH3TC, SIGLECI, SLAMF8, SLC16A3, SLC1A3, SP110, SPI1, SPIB, SSPO, STAT1, TAP1, TAPBP, THBD, TNFa, TRAC, TRIM22, UBE2B, UBQLN4, UBQLN4P, UST, VCAM1, XAF1, ZFP2, ZMIZ2, and ZNF710.

[0042] In some aspects, the lifestyle modification or pharmaceutical treatment is selected from the group consisting of blood pressure reduction, cholesterol level modulation, diabetes treatment, increased exercise, inflammation, obesity and weight reduction, prothrombotic factors treatment, reduction in serum homocysteine and lipoprotein (a), serum triglyceride reduction, smoking cessation, and stress reduction.

[0043] As used herein, the phrase "lifestyle modification" means those activities which an individual may undertake to improve cardiovascular risk factors absent or in conjunction with a pharmaceutical treatment. Representative examples of lifestyle modification include, without limitation, diet modifications for weight reduction, blood pressure or cholesterol control; increased exercise for stress relief or weight reduction; or smoking cessation.
"Pharmaceutical treatment", as used herein, refers to those agents obtained or prescribed by a health care provider which may be used in lieu of, or in conjunction with, lifestyle modifications to promote improved cardiovascular risk factors.

[0044] As used in this specification, whether in a transitional phrase or in the body of the claim, the terms "comprise(s)" and "comprising" are to be interpreted as having an open-ended meaning. That is, the terms are to be interpreted synonymously with the phrases "having at least" or "including at least". When used in the context of a process, the term "comprising" means that the process includes at least the recited steps, but may include additional steps.
When used in the context of a compound or composition, the term "comprising" means that the compound or composition includes at least the recited features or compounds, but may also include additional features or compounds.

[0045] As used herein, the terms "derivatives" or a matter "derived" refer to a chemical substance related structurally to another substance and theoretically obtainable from it, i.e. a substance that can be made from another substance. Derivatives can include compounds obtained via a chemical reaction.

[0046] The term "pharmaceutically acceptable" is used in the sense of being compatible with the other ingredients of the compositions and not deleterious to the recipient thereof.

[0047] As used herein, "tetrahydro-isohumulone" shall refer to the cis and trans forms of (+)-(4R,5S)-3,4-dihydroxy-2-(3-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-l-one and (-)-(4S,5S)-3,4-dihydroxy-2-(3-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-l-one respectively.

[0048] "Tetrahydro-isocohumulone", as used herein refers to the cis and trans forms of (+)-(4R,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-(3-methylpropanoyl)cyclopent-2-en-l-one and (-)-(4S,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-(3-methylpropanoyl)cyclopent-2-en-l-one respectively.

[0049] "Tetrahydro-adhumulone" shall be used herein to refer to the cis and trans forms of (+)-(4R,5S)-3,4-dihydroxy-2-(2-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-l-one and (+)-(4R,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-petanoylcyclopent-2-en-l-one respectively.

[0050] As used herein, "tetrahydro-isoalpha acid" (see Table 1) or "Meta060"
refers to any mixture of one or more of tetrahydro-adhumulone, tetrahydro-isocohumulone and tetrahydro-isohumulone.

Table 1 Tetrahydroisoalpha acids Chemical Name Synonym Structure (4R, 5S)-3,4-dihydroxy-2-(3 methylbutanoyl)-5-(3-methylbutyl)-4-(4- tetrahydro cis n H ". off methylpentanoyl)cyclopent-2-en-1-one iso-alpha acid (4S, 5S)-3,4-dihydroxy-2-(3-tetrahydro trans methylbutanoyl)-5-(3-methylbutyl)-4-(4 Ho OH
methylpentanoyl)cyclopent-2-en-1-one n iso-alpha acid o o O
(4S, 5R)-3,4-dihydroxy-2-(3 methylbutanoyl)-5-(3-methylbutyl)-4-(4 tetrahydro cis n HO. z off methylpentanoyl)cyclopent-2-en-1-one iso-alpha acid 5~
o O
(4R, 5R)-3,4-dihydroxy-2-(3 methylbutanoyl)-5-(3-methylbutyl)-4-(4 tetrahydro trans HO"' off methylpentanoyl)cyclopent-2-en-1-one n iso-alpha acid O
(4R,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4 tetrahydro cis co (4-methylpentanoyl)-2-(3- HO,,, OH
methylpropanoyl)cyclopent-2-en-1-one iso alpha acid (4S,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-(3 tetrahydro trans O~z 1z off methylpropanoyl)cyclopent-2-en-1-one co iso-alpha acid O

(4S,5R)-3,4-dihydroxy-5-(3-methylbutyl)-4 (4-methylpentanoyl)-2-(3 tetrahydro cis co methylpropanoyl)cyclopent-2-en-1-one iso-alpha acid o "

O
(4R,5R)-3,4-dihydroxy-5-(3-methylbutyl)-4 (4-methylpentanoyl)-2-(3- tetrahydro trans HO" OH
methylpropanoyl)cyclopent-2-en-1-one co iso-alpha acid (4R,5S)-3,4-dihydroxy-2-(2- o o methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-1-one tetrahydro cis ad "o,,, iso-alpha acid o o"
(4S,5S)-3,4-dihydroxy-2-(2- o o methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-1-one tetrahydro trans HO OH
ad iso-alpha acid o (4S,5R)-3,4-dihydroxy-2-(2-methylbutanoyl)-5-(3-methylbutyl)-4-(4 methylpentanoyl)cyclopent-2-en-1-one tetrahydro cis ad HO
iso-alpha acid o OH
(4R,5R)-3,4-dihydroxy-2-(2-methylbutanoyl)-5-(3-methylbutyl)-4-(4- 0 methylpentanoyl)cyclopent-2-en-1-one tetrahydro trans HO, ad iso-alpha acid 0 OH

[0051] As used herein, "compounds" may be identified either by their chemical structure, chemical name, or common name. When the chemical structure and chemical or common name conflict, the chemical structure is determinative of the identity of the compound. The compounds described herein may contain one or more chiral centers and/or double bonds and therefore, may exist as stereoisomers, such as double-bond isomers (i.e., geometric isomers), enantiomers or diastereomers. Accordingly, the chemical structures depicted herein encompass all possible enantiomers and stereoisomers of the illustrated or identified compounds including the stereoisomerically pure form (e.g., geometrically pure, enantiomerically pure or diastereomerically pure) and enantiomeric and stereoisomeric mixtures. Enantiomeric and stereoisomeric mixtures can be resolved into their component enantiomers or stereoisomers using separation techniques or chiral synthesis techniques well known to the skilled artisan. The compounds may also exist in several tautomeric forms including the enol form, the keto form and mixtures thereof.
Accordingly, the chemical structures depicted herein encompass all possible tautomeric forms of the illustrated or identified compounds. The compounds described also encompass isotopically labeled compounds where one or more atoms have an atomic mass different from the atomic mass conventionally found in nature. Examples of isotopes that may be incorporated into the compounds of the invention include, but are not limited to, 2H, 3H 13C 14C 15N, 180, 170, etc. Compounds may exist in unsolvated forms as well as solvated forms, including hydrated forms and as N-oxides. In general, compounds may be hydrated, solvated or N-oxides. Certain compounds may exist in multiple crystalline or amorphous forms. Also contemplated within the scope of the invention are congeners, analogs, hydrolysis products, metabolites and precursor or prodrugs of the compound. In general, unless otherwise indicated, all physical forms are equivalent for the uses contemplated herein and are intended to be within the scope of the present invention.

[0052] Compounds according to the invention may be present as salts. In particular, pharmaceutically acceptable salts of the compounds are contemplated. A
"pharmaceutically acceptable salt" of the invention is a combination of a compound of the invention and either an acid or a base that forms a salt (such as, for example, the magnesium salt, denoted herein as "Mg" or "Mag") with the compound and is tolerated by a subject under therapeutic conditions. In general, a pharmaceutically acceptable salt of a compound of the invention will have a therapeutic index (the ratio of the lowest toxic dose to the lowest therapeutically effective dose) of 1 or greater. The person skilled in the art will recognize that the lowest therapeutically effective dose will vary from subject to subject and from indication to indication, and will thus adjust accordingly.

[0053] A second embodiment of the invention describes methods for promoting vascular elasticity in a subject in need, the method comprising treating the subject with a therapeutically effective amount of a substituted 1,3-cyclopentadione compound wherein said amount increases vascular elasticity or dilation. In some aspects of this embodiment the substituted 1,3-cyclopentadione compound is selected from the group comprising (+)-(4R,5S)-3,4-dihydroxy-2-(3-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-l-one, (-)-(4S,5S)-3,4-dihydroxy-2-(3-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-l-one, (+)-(4R,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-(3-methylpropanoyl)cyclopent-2-en-l-one, (-)-(4S,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-(3-methylpropanoyl)cyclopent-2-en-l-one, (+)-(4R,5S)-3,4-dihydroxy-2-(2-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-l-one and (+)-(4R,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-petanoylcyclopent-2-en-l-one.

[0054] Another embodiment describes a composition for promoting cardiovascular health in a subject in need, where the composition comprises a therapeutically effective amount of a substituted 1,3-cyclopentadione compound wherein said amount (a) modulates the expression of cardiovascular risk associated marker gene expression; or (b) increases vascular elasticity or dilation.

[0055] In some aspects, the substituted 1,3-cyclopentadione compound is selected from the group comprising (+)-(4R,5S)-3,4-dihydroxy-2-(3-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-l-one, (-)-(4S,5S)-3,4-dihydroxy-2-(3-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-l-one, (+)-(4R,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-(3-methylpropanoyl)cyclopent-2-en-l-one, (-)-(4S,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-(3-methylpropanoyl)cyclopent-2-en-l-one, (+)-(4R,5S)-3,4-dihydroxy-2-(2-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-l-one and (+)-(4R,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-petanoylcyclopent-2-en-l-one.

[0056] In yet other aspects of this embodiment the composition further comprises a pharmaceutically acceptable excipient wherein the pharmaceutically acceptable excipient is selected from the group consisting of coatings, isotonic and absorption delaying agents, binders, adhesives, lubricants, disintergrants, coloring agents, flavoring agents, sweetening agents, absorbants, detergents, and emulsifying agents. Additionally, in other aspects the composition further comprises one or more members selected from the group consisting of antioxidants, vitamins, minerals, proteins, fats, and carbohydrates.

[0057] In other aspects of this embodiment, the substituted 1,3-cyclopentadione compound utilized in the composition is greater than 50% pure, preferably greater than 75% pure, more preferably greater than 90% pure and most preferably greater than 95% pure for the identified stereoisomer (the remaining amount being the alternative isomeric form). In some aspects the composition comprises from about 50 mg to 10,000 mg, preferably 100 mg to 8,000 mg, or most preferably 150 mg to 6,000 mg of the substituted 1,3-cyclopentadione compound per dosage.

[0058] The compounds according to the invention are optionally formulated in a pharmaceutically acceptable vehicle with any of the well known pharmaceutically acceptable carriers, including diluents and excipients [see Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, Mack Publishing Co., Easton, PA 1990 and Remington: The Science and Practice of Pharmacy, Lippincott, Williams & Wilkins, 1995]. While the type of pharmaceutically acceptable carrier/vehicle employed in generating the compositions of the invention will vary depending upon the mode of administration of the composition to a mammal, generally pharmaceutically acceptable carriers are physiologically inert and non-toxic. Formulations of compositions according to the invention may contain more than one type of compound of the invention), as well as any other pharmacologically active ingredient useful for the treatment of the symptom/condition being treated.

[0059] The compounds of the present invention may be provided in a pharmaceutically acceptable vehicle using formulation methods known to those of ordinary skill in the art. The compositions of the invention can be administered by standard routes, though preferably administration is by inhalation routes. The compositions of the invention include those suitable for oral, inhalation, rectal, ophthalmic (including intravitreal or intracameral), nasal, topical (including buccal and sublingual), vaginal, or parenteral (including subcutaneous, intramuscular, intravenous, intradermal, and intratracheal). In addition, polymers may be added according to standard methodologies in the art for sustained release of a given compound.

[0060] Formulations suitable for administration by inhalation include formulations that can be dispensed by inhalation devices known to those in the art. Such formulations may include carriers such as powders and aerosols. The present invention encompasses liquid and powdered compositions suitable for nebulization and intrabronchial use, or aerosol compositions administered via an aerosol unit dispensing metered doses ("MDI").The active ingredient may be formulated in an aqueous pharmaceutically acceptable inhalant vehicle, such as, for example, isotonic saline or bacteriostatic water and other types of vehicles that are well known in the art. The solutions are administered by means of a pump or squeeze-actuated nebulized spray dispenser, or by any other conventional means for causing or enabling the requisite dosage amount of the liquid composition to be inhaled into the patient's lungs. Powder compositions containing the anti-inflammatory compounds of the present invention include, by way of illustration, pharmaceutically acceptable powdered preparations of the active ingredient thoroughly intermixed with lactose or other inert powders acceptable for intrabronchial administration. The powder compositions can be administered via a dispenser, including, but not limited to, an aerosol dispenser or encased in a breakable capsule which may be inserted by the patient into a device that punctures the capsule and blows the powder out in a steady stream. Aerosol formulations for use in the subject method typically include propellants, surfactants, and co-solvents and may be filled into conventional aerosol containers that are closed by a suitable metering valve.

[0061] Formulations of compositions of the present invention suitable for nasal administration, wherein the carrier is a solid, include a coarse powder having a particle size, for example, in the range of 20 to 500 microns which is administered in the manner in which snuff is administered, i.e., by rapid inhalation through the nasal passage from a container of the powder held close up to the nose. Suitable formulations, wherein the carrier is a liquid, for administration, for example via a nasal spray, aerosol, or as nasal drops, include aqueous or oily solutions of the compound of the invention.

[0062] For oral administration, the compositions of the invention may be presented as discrete units such as capsules, caplets, gelcaps, cachets, pills, or tablets each containing a predetermined amount of the active ingredient as a powder or granules; as a solution or a suspension in an aqueous liquid or a non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil emulsion and as a bolus, etc. Alternately, administration of a composition of all of the aspects of the present invention may be effected by liquid solutions, suspensions or elixirs, powders, lozenges, micronized particles and osmotic delivery systems.

[0063] Formulations of compositions according to the aspects of the present invention suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions which may contain antioxidants, stabilizers, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampules and vials, and may be stored in a freeze-dried (lyophilized) conditions requiring only the addition of the sterile liquid carrier, for example, water for injections, immediately prior to use.
Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.

[0064] A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared by compressing, in a suitable machine, the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, preservative, surface active or dispersing agent. Molded tablets may be made by molding, in a suitable machine, a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may be optionally coated or scored and may be formulated to provide a slow or controlled release of the active ingredient therein.

[0065] Formulations of compositions of the present invention for rectal administration may be prepared as a suppository with a suitable base comprising, such as, for example, cocoa butter.

[0066] Formulations of compositions of the present invention suitable for topical administration in the mouth include lozenges comprising the ingredients in a flavored basis, usually sucrose and acacia or tragacanth; pastilles comprising the active ingredient in an inert basis such as gelatin and glycerin, or sucrose and acacia; and mouthwashes comprising the ingredient to be administered in a suitable liquid carrier. Formulations of compositions of the present invention suitable for topical administration to the skin may be presented as ointments, creams, gels, lotions and pastes comprising the ingredient to be administered in a pharmaceutical acceptable carrier. A
topical delivery system contemplated is a transdermal patch containing the ingredient to be administered.

[0067] Formulations of compositions according to the aspects of the present invention suitable for vaginal administration may be presented as pessaries, suppositories, tampons, creams, gels, pastes, foams or spray formulations containing in addition to the compound of the invention such pharmaceutically acceptable carriers as are known in the art to be appropriate.

[0068] The term "modulate" or "modulation" is used herein to mean the up or down regulation of expression or activity of the gene by a compound, ingredient, etc., to which it refers.

[0069] As used herein, the term "protein kinase" represents transferase class enzymes that are able to transfer a phosphate group from a donor molecule to an amino acid residue of a protein.
See Kostich, M., et al., Human Members of the Eukaryotic Protein Kinase Family, Genome Biology 3(9):research0043.1-0043.12, 2002 herein incorporated by reference in its entirety, for a detailed discussion of protein kinases and family/group nomenclature.

[0070] The methods and compositions of the present invention are intended for use with any mammal that may experience the benefits of the methods of the invention.
Foremost among such mammals are humans, although the invention is not intended to be so limited, and is applicable to veterinary uses. Thus, in accordance with the invention, "mammals" or "mammal in need"
include humans as well as non-human mammals, particularly domesticated animals including, without limitation, cats, dogs, and horses.

[0071] As used herein, by "treating" is meant reducing, preventing, and/or reversing the symptoms in the individual to which a compound of the invention has been administered, as compared to the symptoms of an individual not being treated according to the invention. A
practitioner will appreciate that the compounds, compositions, and methods described herein are to be used in concomitance with continuous clinical evaluations by a skilled practitioner (physician or veterinarian) to determine subsequent therapy. Hence, following treatment the practitioners will evaluate any improvement in reducing cardiovascular risk factors or associated dyregularities according to standard methodologies. Such evaluation will aid and inform in evaluating whether to increase, reduce or continue a particular treatment dose, mode of administration, etc.

[0072] It will be understood that the subject to which a compound of the invention is administered need not suffer from a specific traumatic state. Indeed, the compounds of the invention may be administered prophylactically, prior to any development of symptoms. The term "therapeutic," "therapeutically," and permutations of these terms are used to encompass therapeutic, palliative as well as prophylactic uses. Hence, as used herein, by "treating or alleviating the symptoms" is meant reducing, preventing, and/or reversing the symptoms of the individual to which a compound of the invention has been administered, as compared to the symptoms of an individual receiving no such administration.

[0073] The term "therapeutically effective amount" is used to denote treatments at dosages effective to achieve the therapeutic result sought. Furthermore, one of skill will appreciate that the therapeutically effective amount of the compound of the invention may be lowered or increased by fine tuning and/or by administering more than one compound of the invention, or by administering a compound of the invention with another compound. See, for example, Meiner, C.L., "Clinical Trials: Design, Conduct, and Analysis," Monographs in Epidemiology and Biostatistics, Vol. 8 Oxford University Press, USA (1986). The invention therefore provides a method to tailor the administration/treatment to the particular exigencies specific to a given mammal. As illustrated in the following examples, therapeutically effective amounts may be easily determined for example empirically by starting at relatively low amounts and by step-wise increments with concurrent evaluation of beneficial effect.

[0074] It will be appreciated by those of skill in the art that the number of administrations of the compounds according to the invention will vary from patient to patient based on the particular medical status of that patient at any given time including other clinical factors such as age, weight and condition of the mammal and the route of administration chosen.

[0075] As used herein, "symptom" denotes any sensation or change in bodily function that is experienced by a patient and is associated with a particular disease, i.e., anything that accompanies "X" and is regarded as an indication of "X"'s existence. It is recognized and understood that symptoms will vary from disease to disease or condition to condition. By way of non-limiting examples, symptoms associated with autoimmune disorders include fatigue, dizziness, malaise, increase in size of an organ or tissue (for example, thyroid enlargement in Grave's Disease), or destruction of an organ or tissue resulting in decreased functioning of an organ or tissue (for example, the islet cells of the pancreas are destroyed in diabetes).

[0076] "Inflammation" or "inflammatory condition" as used herein refers to a local response to cellular injury that is marked by capillary dilatation, leukocytic infiltration, redness, heat, pain, swelling, and often loss of function and that serves as a mechanism initiating the elimination of noxious agents and of damaged tissue. Representative symptoms of inflammation or an inflammatory condition include, if confined to a joint, redness, swollen joint that's warm to touch, joint pain and stiffness, and loss of joint function. Systemic inflammatory responses can produce "flu-like" symptoms, such as, for instance, fever, chills, fatigue/loss of energy, headaches, loss of appetite, and muscle stiffness.

[0077] The following examples are intended to further illustrate certain preferred embodiments of the invention and are not limiting in nature. Those skilled in the art will recognize, or be able to ascertain, using no more than routine experimentation, numerous equivalents to the specific substances and procedures described herein.

EXAMPLES
Example 1 [0078] The purpose of this Example was to determine the effects of substituted 1,3-cyclopentadione compounds on protein kinase activity, especially that associated with the expression of selected cardiovascular risk associated markers and, additionally, on monocyte -endothelial cell interactions.

[0079] The inhibition of META-060 on in vitro kinase activity: In a final reaction volume of 25 l the kinase of interest (5-10 mU) was incubated with the specific buffer and peptide substrate, mM MgAcetate and [y-33P-ATP]. The reaction was initiated by the addition of the MgATP mix.
After incubation for 40 minutes at room temperature, the reaction was stopped by the addition of 5 l of a 3% phosphoric acid solution. 10 l of the reaction was then spotted onto a P30 filtermat and washed three times for 5 minutes in 50 mM phosphoric acid and once in methanol prior to drying and scintillation counting.

[0080] The inhibition of META-060 on TNFa induced VCAMJ, E-selectin and MCP-1 in HAEC cells. HAEC cells were pre-incubated with various concentrations of META-060 (10, 5 and 1 mg/ml) for 1 hr and stimulated with TNFa (lOng/ml) for 8 hrs. VCAM-/E-Selectin levels were measured by cell based ELISA method using antibodies for VCAM-1 and E-selectin and fold induction was calculated over unstimulated (control) cells. For MCP-1, the cell media were measured using human MCP-1 immunoassay kits (R&D Systems). Data represent Mean SD of 8 individual samples.

[0081] The inhibition of META-060 on TNFa induced Monocyte-Endothelial interactions:
The adhesion of fluorescently labeled human monocytic (THP-1) cells to confluent monolayers of HAECs was measured by using a microplate-based assay. HAEC or THP-1 cells were pre-incubated with META-060 (10mg/ml) and Parthenolide (lOmM) for lhr and stimulated with TNFa (lOng/ml) for 8 hrs. THP-1 cells were labeled with the fluorescent dye BCECF-AM (1 mM
final concentration; Sigma) in HBSS medium for 30 min at 4 C. Then cells were washed twice with (37 C) HBSS medium and resupended in EGM2 medium. 100,000 THP-1 cells were added to each well (96 well plate) and incubated for 30 min. Unbound THP-lcells were washed twice with PBS by centrifugation by putting plate upside down with seal. Standard curve for BCECF-AM labeled THP-1 cells were generated. 200 l of PBS were added to each well, and fluorescence was measured using Vector2 (Perkin Elmer) fluorescent plate reader (excitation:
485 nm; emission: 535 nm). THP-1 stimulation (A). THP-1 cells without stimulation, (B). THP-1 cell with TNFa, (C) THP-1 cells with parthenolide (1Oug/ml) and TNFa (D) THP-1 cells with META-060 (1Oug/ml) and TNFa. Data represent Mean SD of 6 individual samples.

[0082] Results - The results are presented in Figures 1 - 3 and Table 2 below.
Table 2.

Gini Coefficients and Hit Rate (>50% Inhibition) for 40 inhibitors against 85 Kinases (see Supporting Information) at 10 iM(G10) Inhibitor Concn (uM) Gio hit rate AG1024 10 0.568 11 AG1296 10 0.498 4 AG1478 10 0.500 25 AG18 10 0.680 1 AG183 10 0.460 14 AG538 10 0.417 17 Alsterpaullone 1 0.633 22 Calphostin C 10 0.606 2 Cdk2/5 inh. 10 0.555 7 Curcumin 50 0.417 38 EGCG 10 0.495 21 Genistein 10 0.582 0 H89 10 0.442 34 HA1077 10 0.650 19 Herbimycin A 10 0.534 0 Hispidin 10 0.790 2 Indirubin 10 0.291 52 JNK inh II 10 0.445 35 K252c 10 0.236 58 KT5720 1 0.423 33 Lavendustin A 1 0.726 0 Lavendustin B 1 0.515 0 LY294002 50 0.619 6 Olomoucin 50 0.556 13 PD153035 0.001 0.616 0 PD184352 10 0.802 1 PP1 analogue 1 0.758 15 PP2 1 0.722 14 PP3 1 0.634 0 Ro31-8220 1 0.432 39 Roscovitine 10 0.744 10 Rottlerin 10 0.595 3 SB202190 10 0.553 29 SB203580 10 0.621 17 ST638 10 0.568 14 Staurosporine 1 0.093 78 SU6656 1 0.607 19 Wortmannin 1 0.775 0 Y27632 10 0.628 13 ZM336372 10 0.635 11 Graczyk PP, Journal of Medicinal Chemistry, 2007 [0083] The data presented show that Meta-060: a) inhibits TNFa mediated MCP-1, VCAM-1 and E-selectin expression in endothelial cells; b) inhibits TNFa mediated THP-I-HAEC
cell interactions; c) inhibits kinases involved in inflammatory signaling pathways, such as, PKCbII, NF-kB, P13K and GSK3; and d) Gini-coefficient value of 0.81 at 13uM
concentration, suggesting that META-060 shows high specificity for kinase inhibition.

[0084] The development of kinase inhibitors is complicated by their relative lack of specificity [Bain, Biochem J 2003, Graczek 2007] resulting in off-target side effects. In a review article, Graczek proposed the Gini-coefficient (0= lack specificity, 1=highest specificity), as a method to predict the specificity of kinase inhibitors against a panel of kinases. Forty commercially available inhibitors were tested for the inhibition of 85 kinases with Gini-coefficient ranging from 0.1 to 0.8. Here we add for comparison.

Example 2 [0085] The purpose of this study was to evaluate the effect of substituted 1,3-cyclopentadione compounds on monocyte-endothelial interactions, expression of MCP-1 and MMP-9 levels in monocytic cells, THP-1. Additionally evaluated was the expression of various inflammatory genes in TNFa activated THP-1 cells and in vitro kinase screening of over 250 kinases in cell free enzyme assays [0086] THP-1 and HAEC cell interactions (A). Human monocytic cell line, THP-1 were incubated with Low (5mM) and High (25mM) glucose for eight days. THP-1 cells were treated with THIAA for 8 hrs. B. THP-1 cells were activated with TNFa for 8 hrs in the presence and absence of test compound for 1 hr. Cells were labeled with BCECF for 30 min and added on monolayers of human endothelial cells (HAEC) for 30 min. Number of THP-1 cells bound to the wells were measured using standard curve from BCECF labeled THP-1cells and fold induction was calculated from average of eight samples.

[0087] MCP-1 Expression: The inhibition of META-060 on TNFa (lOng/ml), LPS
(lug/ml) and cytokines (TNFa, Il-lb and IFNg, IOng/ml each) induced MCP-1 production in THP-1 cells. Cells were pre-incubated with various concentrations of META-060 for 1 hr and stimulated with TNFa (lOng/ml) for 24 hrs. MCP-l levels were measured using human MCP-l immunoassay kits (R&D Systems). Data represent Mean SD of 8 samples.

[0088] MMP-9 Expression: The inhibition of META-060 on TNFa (lOng/ml) and LPS
(lug/ml) induced MMP-9 production in THP-1 cells. Cells were pre-incubated with various concentrations of META-060 for 1 hr and stimulated with A. TNFa (lOng/ml) or (B) LPS (lug/ml) for 24 hrs. MMP-9 levels in the medium were measured using human MMP-9 immunoassay kits (GE Healthcare). Data represent Mean SD of a representative experiment. For MMP-9 activity (C) LPS conditioned medium was mixed 1:1 with Novex buffer (Invitrogen) and electrophoresed in 10% SDS-PAGE containing 0.1% gelatin. Gels were renaturated by exchanging SDS
for Triton X-100 (2.5%), followed by 24 h incubation at 37 C in activation buffer (50 mmol/L Tris, pH 7.6; 5 mmol/ L CaC12; 0.2 mol/L NaCl and 0.02% Brij). Gels were subsequently stained with Coomassie staining solution (0.5% Coomassie R250; 30% MeOH; 10% acetic acid) for 2 h, followed by destaining (50% MeOH and 10% acetic acid).

[0089] Electrophoretic mobility shift assays (EMSA): THP-1 cells were pre-incubated with test compounds for 1 hr and stimulated with LPS (1 g/ml) for 2 hrs. Nuclear extracts were prepared essentially as described by Dignam, et al [Nucl. Acids. Res 11:1475-1489) and NF-kB binding to DNA was assessed using electrophoretic mobility shift assay with labeled NF-kB
consensus DNA
probe (5' AGTTGAGGGGACTTTCCCAGGC).

[0090] Regulation of protein phosphorylation in THP-1 cells: THP-1 cells were seeded in 6 well plate, pre-incubated in the presence and absence of META-060 (20ug/ml)) for 1 hr and stimulated with TNFa (lOng/ml) or LPS (IOug/ml) for 1 hr. Cell lysates were prepared as per the instructions from user manual from MILLIPLEX MAP technology (Millipore, Billerica, MA).

Multi-Pathway Signaling kit is used to detect changes in phosphorylated Erk/MAP kinase 1/2 (Thrl85/Tyrl87), STAT3 (Ser727), STATSA/B (Tyr694/699), JNK (Thrl83/Tyrl85), p70 S6 kinase (Thr412) and p38 (Thrl80/Tyrl82) in cell lysates using the Luminex system. Cell lysate (25ug/well) were used and phosphoproteins were measured in the lysates as per the instructions and fold inductions were calculated using unstimulated samples as a control (Table 3 & 4).

Table 3:

Effect of Meta060 on TNFa mediated protein phosphorylation in THP-1 cells Meta060 (ug/ml) + TNFa (l Ong/ml) Control TNFa Phosphoproteins (Unstimulated) (1Ong/ml) 20ug 1Oug 5ug Erkl/2 1.0 1.5 1.4 1.6 1.6 STAT3 1.0 1.4 1.2 1.2 1.4 JNK 1.0 1.3 1.0 0.8 1.1 p70 S6K 1.0 1.3 1.1 1.0 1.6 STATSA/B 1.0 0.8 0.7 0.4 1.3 p38 1.0 2.0 1.5 1.4 1.6 Table 4:

Effect of Meta060 on LPS mediated protein phosphorylation in THP-1 cells.

Meta060 (ug/ml) + LPS (1Oug/ml) Control Phosphoproteins (Unstimulated) LPS (1Oug/ml) 20ug 1Oug 5ug JNK 1.0 7.2 3.6 5.0 5.5 p70 S6K 1.0 1.5 0.7 0.9 1.5 STAT5A/B 1.0 1.5 1.4 1.1 1.0 p38 1.0 7.0 5.4 4.8 6.5 [0091] Regulation of transcriptional factors in THP-1 cells: THP-1 cells were seeded in 100mm dish, pre-incubated with META-060 (10mg/ml)) for 1 hr and stimulated with TNFa (l0ng/ml) or LPS (10ug/ml) for 2 hrs. Nuclear extracts were prepared as per the instructions from user manual (Panomics, CA). Transcriptional factors were measured using Procarta Transcription Factor Plex panel 1 (Panomics, CA) according to the manufacturer instructions using Luminex 200.
The fold induction was calculated from 3 measurements. TFIID was used as an internal control and unstimulated samples used to calculate fold induction. The data is presented in Tables 5 & 6.

Table 5:

Effect of Meta060 on TNFa mediated transcriptional factors in THP-1 cells Control Meta060 (20ug/ml) (unstimulated) TNFa (1 Ong/ml) +TNFa (10ng/ml) ELK-1 1.00 0.87 1.09 NFkB 1.00 1.86 1.40 FAST-1 1.00 1.40 1.21 OCT 1.00 1.21 0.98 P53 1.00 1.96 1.89 PAX-3 1.00 1.20 0.92 NF-E2 1.00 1.84 1.42 AP-2 1.00 1.35 1.11 NF-E1(YY1) 1.00 2.38 2.71 ATF-2 1.00 1.50 1.18 NF-1 1.00 2.13 1.77 ISRE 1.00 1.93 1.61 PAX-5 1.00 1.15 1.37 Nkx-2.5 1.00 1.60 1.25 AR 1.00 1.71 1.32 ETS/PEA 1.00 1.42 1.17 AP-1 1.00 1.91 1.18 E2F1 1.00 1.86 1.70 MyoD 1.00 1.67 1.48 PPAR 1.00 2.01 1.19 RUNX/AML 1.00 1.40 0.90 Brm3 1.00 0.44 0.75 NF-Y 1.00 2.44 1.87 c-myb 1.00 1.42 1.08 CREB 1.00 1.74 1.35 ER 1.00 1.60 1.30 GR/PR 1.00 1.43 1.25 HIF-1 1.00 1.74 1.45 FKHR 1.00 1.31 0.96 GATA 1.00 1.44 1.10 IRF 1.00 1.74 1.43 STAT-1 1.00 0.90 0.79 HNF1 1.00 1.11 1.07 STAT-4 1.00 1.32 1.09 STAT-5 1.00 1.27 1.19 MEF-2 1.00 1.24 0.97 NFAT 1.00 1.10 0.73 Table 6:

Effect of Meta060 on LPS mediated transcriptional factors in THP-1 cells Meta060 (20ug/ml) Control (Unstimulated) LPS (10ug/ml) +LPS (10ug/ml) ELK-1 1.00 0.38 0.57 NFkB 1.00 3.20 0.83 FAST-1 1.00 1.24 1.45 OCT 1.00 0.72 0.69 P53 1.00 1.19 2.60 PAX-3 1.00 0.92 0.81 NF-E2 1.00 2.71 2.11 AP-2 1.00 0.91 1.05 NF-E1(YYI) 1.00 1.16 2.46 ATF-2 1.00 1.31 1.10 NF-1 1.00 1.46 1.86 ISRE 1.00 1.14 2.77 PAX-5 1.00 1.42 0.75 Nkx-2.5 1.00 0.97 1.47 AR 1.00 1.40 2.63 ETS/PEA 1.00 0.88 0.95 AP-1 1.00 4.06 1.42 E2F1 1.00 1.68 2.92 MyoD 1.00 0.88 1.65 PPAR 1.00 1.07 1.04 RUNX/AML 1.00 1.42 1.10 Brm3 1.00 0.22 0.13 NF-Y 1.00 1.68 2.02 c-myb 1.00 1.03 1.92 CREB 1.00 1.71 1.77 ER 1.00 1.31 2.36 GR/PR 1.00 0.69 1.75 HIF-1 1.00 1.54 2.45 FKHR 1.00 1.04 0.93 GATA 1.00 0.88 1.37 IRF 1.00 0.83 1.13 STAT-1 1.00 0.71 0.53 HNF1 1.00 0.77 1.42 STAT-4 1.00 0.81 1.07 STAT-5 1.00 1.09 0.94 MEF-2 1.00 0.75 0.79 NFAT 1.00 0.70 0.53 [0092] Human Gene array analysis: THP-1 cells were pre-incubated with META-060 (10mg/ml) or parthenolide (10mM) for 1 hr and stimulated with TNFa (lOng/ml) for 4 hrs. Genes were analyzed using Affymetrix human genome array U133A 2.0 and measured 22,000 transcripts (by Expression Analysis Inc, North Carolina). Genes which are known to activate endothelial and monocyte interactions were shown. Each value represent Mean of 2 independent measurements.

[0093] Results - The results for this Example are presented in Figures 4 - 8 and Table 7 and indicate that META-060 inhibits: a) Hyperglycemia and TNFa mediated, THP-1-HAEC cell interactions; b) Cytokines and LPS mediated MCP-1 secretion; c) TNFa and LPS
activated MMP-9 levels; d) LPS mediated NF-kB binding; and e) TNFa mediated inflammatory genes including, MCP-1, VCAM, ICAM-1, MMP-9 and TNFa in THP-1 cells.

Table 7 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 209387sat 4071 TM4SF M90657 7.77 32.01 0.77 0.02 7.77 4.26 8.92 216307_at 1607 DGKB AB01826 1.77 22.51 0.71 0.03 1.77 2.84 5.19 207837_at 11030 RBPMS NM_0068 4.20 24.09 0.77 0.03 4.20 5.37 17.29 208529_at 690 BTF3L NM_0012 4.85 26.42 0.99 0.04 4.85 3.48 0.80 216923_at 6792 CDKL5 AL04968 8.08 34.36 1.35 0.04 8.08 20.57 33.50 207679_at 5077 PAX3 NM_0004 9.48 40.46 2.02 0.05 9.48 25.09 2.74 0.11 215523 at 346157 RP1- AL03111 7.54 26.87 1.38 0.05 7.54 5.16 19.70 .3 211525_s_at 2814 GP5 L11238 6.37 18.86 0.98 0.05 6.37 3.45 15.65 216787_at 2281 FKBP1 AK02627 8.41 55.23 2.89 0.05 8.41 13.95 7.39 0.53 220820_at NM_0185 21.18 39.60 2.19 0.06 21.18 14.35 31.81 208045_at 9981 SPAR NM_0051 16.48 25.57 1.44 0.06 16.48 16.54 4.07 206446_s_at 63036 ELA2A NM_0019 3.65 25.64 1.47 0.06 3.65 18.52 1.86 0.10 207527_at 3765 KCNJ9 NM_0049 8.00 53.09 3.08 0.06 8.00 18.72 11.49 0.61 220474 at 89874 SLC25 NM0306 3.74 15.58 0.94 0.06 3.74 10.94 10.48 211522_s_at 2798 GNRH L03380 0.71 22.66 1.41 0.06 0.71 1.92 3.48 R

220187_at 79689 STEAP NM_0246 2.65 31.68 2.01 0.06 2.65 5.09 5.01 221322_at 64111 NPVF NM_0221 0.99 20.28 1.35 0.07 0.99 1.71 5.69 219136 sat 64788 TMEM NM 0227 7.70 35.86 2.40 0.07 7.70 3.74 4.74 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 205886_at 5968 REG1B NM_0065 10.51 33.27 2.25 0.07 10.51 4.49 9.15 217265_at 51090 PLLP AL02098 2.32 23.95 1.62 0.07 2.32 1.62 4.05 217213_at 6530 SLC6A AB02284 1.94 23.63 1.67 0.07 1.94 5.60 2.77 209183_s_at 11067 CIOorfl AL13665 17.77 130.43 9.25 0.07 17.77 34.77 15.72 0.45 207912_s_at 1617 /// DAZ1 U21663 4.20 27.76 1.97 0.07 4.20 15.41 9.48 0.62 DAZ
205430_at 653 BMP5 NM_0210 2.72 17.89 1.30 0.07 2.72 1.41 0.99 220222_at 55472 C8orf39 NM_0186 3.66 30.66 2.30 0.07 3.66 4.12 4.62 215117_at 5897 RAG2 AW05814 8.35 18.61 1.41 0.08 8.35 4.91 3.71 209988_s_at 429 ASCL1 BC00163 8.11 14.39 1.09 0.08 8.11 1.55 9.42 206941_x_at 9723 SEMA3 NM_0124 4.04 19.31 1.49 0.08 4.04 1.01 3.56 213197_at 460 ASTN1 AB00662 1.54 20.39 1.59 0.08 1.54 8.60 3.80 216598_s_at 6347 CCL2 S69738 13.11 2860.66 222.78 0.08 13.11 430.87 121.62 0.28 216839_at 3908 LAMA AK02682 2.73 14.41 1.12 0.08 2.73 16.92 14.17 216134_at 23150 FRMD4 AK00024 14.80 26.35 2.07 0.08 14.80 12.75 8.25 206300_s_at 5744 PTHLH NM_0028 10.21 15.70 1.24 0.08 10.21 21.67 3.62 0.17 202196_s_at 27122 DKK3 NM_0132 2.32 18.77 1.50 0.08 2.32 3.00 6.94 216986_s_at 3662 IRF4 D78261 30.30 58.93 4.80 0.08 30.30 28.46 13.55 222258_s_at 23677 SH3BP AF01504 3.89 22.00 1.80 0.08 3.89 6.77 9.89 210016_at 23040 MYT1L BF22300 6.75 31.55 2.59 0.08 6.75 12.00 10.95 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 210116_at 4068 SH2D1 AF07293 1.34 52.10 4.35 0.08 1.34 5.61 13.15 215795_at 57644 MYH7 AK00094 5.19 18.50 1.56 0.08 5.19 4.94 2.39 204612_at 5569 PKIA NM_0068 8.28 23.53 2.00 0.09 8.28 14.37 2.71 0.19 219803_at 27329 ANGPT NM_0144 10.26 29.88 2.58 0.09 10.26 12.07 2.39 206666_at 3003 GZMK NM_0021 3.15 49.67 4.34 0.09 3.15 10.81 7.38 0.68 220807_at 3049 HBQ1 NM_0053 10.08 32.36 2.89 0.09 10.08 2.86 11.50 220880_at NM_0186 3.53 27.80 2.50 0.09 3.53 7.47 7.17 205460_at 4862 NPAS2 NM_0025 14.34 30.55 2.75 0.09 14.34 38.35 16.29 0.42 219827_at 7352 UCP3 NM_0033 27.43 67.56 6.24 0.09 27.43 19.79 31.19 221347_at 1133 CHRM NM_0121 3.09 21.42 1.98 0.09 3.09 15.25 4.10 0.27 208525_s_at 135948 OR2F1 NM_0123 1.30 28.88 2.68 0.09 1.30 3.15 4.84 220314 at 51402 // HSFX1 NM 0161 4.81 35.95 3.35 0.09 4.81 6.22 7.54 220460_at 53919 SLCO1 NM_0174 17.61 26.61 2.50 0.09 17.61 4.89 6.94 216003_at 374286 CDRT1 U43383 15.63 27.12 2.55 0.09 15.63 6.37 2.41 207910_at 10648 SCGB 1 NM_0065 0.73 14.86 1.40 0.09 0.73 1.70 0.92 217412_at AE00065 5.42 22.08 2.08 0.09 5.42 3.44 6.72 216641_s_at 3898 LAD1 U58994 10.18 46.17 4.35 0.09 10.18 17.11 3.57 0.21 216939_s_at 3360 HTR4 Y08756 7.77 26.90 2.55 0.09 7.77 11.29 3.96 207909_x_at 1617 /// DAZ1 U21663 3.69 12.24 1.17 0.10 3.69 4.26 4.16 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) DAZ

211044_at 9830 TRIM1 BC00633 15.45 59.97 5.79 0.10 15.45 27.99 5.98 0.21 217350_at 160313 LOC16 AB04126 4.57 15.56 1.53 0.10 4.57 4.28 2.30 204464_s_at 1909 EDNR NM_0019 14.40 26.56 2.64 0.10 14.40 6.32 7.03 208497xat 4762 NEUR NM 0061 19.48 61.49 6.14 0.10 19.48 74.79 87.44 210713_at 6453 ITSN1 U61166 6.26 22.08 2.23 0.10 6.26 7.49 5.93 207640_x_at 4917 NTN2L NM_0061 11.60 58.01 5.88 0.10 11.60 13.16 10.71 220010_at 23630 KCNE1 NM_0122 29.49 48.71 4.94 0.10 29.49 26.70 28.21 204878_s_at 9344 TAOK2 NM_0047 13.61 80.91 8.23 0.10 13.61 35.30 46.05 204424_s_at 55885 LMO3 AL05015 19.24 31.57 3.22 0.10 19.24 24.51 7.04 215784_at 913 CD1E AA30951 6.86 43.27 4.45 0.10 6.86 9.32 1.24 207070_at 5995 RGR NM_0029 10.13 52.32 5.53 0.11 10.13 5.17 30.01 203903_s_at 9843 HEPH NM_0147 3.20 36.29 3.85 0.11 3.20 27.70 20.68 0.75 210850_s_at 2002 ELK1 AF00067 22.89 40.28 4.28 0.11 22.89 4.24 11.26 212278xat 7337 UBE3A BF58851 18.75 41.53 4.42 0.11 18.75 3.29 11.11 215796_at BF97676 3.69 20.46 2.20 0.11 3.69 3.52 14.70 207077_at 51032 ELA2B NM_0158 23.57 40.66 4.40 0.11 23.57 10.79 25.59 206842_at 3750 KCND1 NM_0049 17.40 49.85 5.40 0.11 17.40 75.09 54.08 0.72 AFFX-r2-Bs- AFFX-r2- 21.90 43.37 4.70 0.11 21.90 9.16 16.25 thr-M s at Bs-thr-M

215468_at 647070 LOC64 AK00144 18.02 32.66 3.57 0.11 18.02 17.14 8.13 220450 at 646593 LOC64 NM 0249 4.35 12.48 1.37 0.11 4.35 10.12 4.30 0.42 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 220916_at 80188 FLJ133 NM_0251 12.10 33.61 3.69 0.11 12.10 16.15 19.97 220506_at 2974 GUCY1 NM_0041 3.63 15.14 1.67 0.11 3.63 4.63 3.26 214410_at 4308 TRPM1 N32151 10.51 18.87 2.09 0.11 10.51 6.91 4.05 216927_at AC00303 7.46 27.89 3.11 0.11 7.46 12.19 16.44 216893_s_at 1285 COL4A U02519 10.39 29.16 3.26 0.11 10.39 11.40 15.20 219167_at 51285 RASL1 NM_0165 44.41 69.87 7.86 0.11 44.41 6.60 25.12 220619_at 55636 CHD7 NM_0177 3.84 20.71 2.34 0.11 3.84 9.81 27.35 210823_s_at 5802 PTPRS U40317 8.22 32.00 3.63 0.11 8.22 29.63 25.27 214451_at 7021 TFAP2 NM_0032 6.56 10.50 1.20 0.11 6.56 4.13 2.26 220552_at 7224 TRPCS NM_0124 2.04 25.60 2.92 0.11 2.04 5.31 3.71 215225_s_at 2840 GPR17 Z94154 5.57 18.41 2.12 0.11 5.57 6.78 21.51 214008_at 5756 TWF1 N25562 22.51 47.26 5.46 0.12 22.51 30.76 26.92 221087_s_at 80833 APOL3 NM0143 17.01 35.33 4.08 0.12 17.01 11.31 14.20 214145_s_at 6710 SPTB BG22334 9.29 47.02 5.44 0.12 9.29 10.10 6.43 217119_s_at 2833 CXCR3 Z79783 61.47 134.49 15.64 0.12 61.47 13.05 12.26 222174_at 4149 MAX AU14502 11.80 31.26 3.64 0.12 11.80 6.18 20.16 211843_x_at 1551 CYP3A AF31532 4.01 28.96 3.39 0.12 4.01 21.66 7.47 0.35 207846_at 5449 POU1F NM_0003 2.72 19.22 2.25 0.12 2.72 12.41 3.55 0.29 208059_at 1237 CCR8 NM_0052 8.05 38.33 4.49 0.12 8.05 16.31 10.86 0.67 206982_at 1411 CRYB NM_0052 7.77 15.73 1.85 0.12 7.77 5.91 2.26 Al 08 216588_at 120872 RPL7 AL03157 10.70 16.25 1.92 0.12 10.70 21.61 7.10 0.33 ///

EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 210504_at 10661 KLF1 U65404 5.69 38.42 4.57 0.12 5.69 35.03 1.70 0.05 220214_at 7762 ZNF21 NM_0132 8.69 33.83 4.05 0.12 8.69 15.46 5.57 0.36 207255_at 3953 LEPR NM_0023 15.52 35.32 4.24 0.12 15.52 9.79 10.04 208139_s_at NM_0312 3.66 31.29 3.79 0.12 3.66 1.55 5.67 217409_at 4644 MYOS Z22957 5.67 10.30 1.25 0.12 5.67 2.68 1.50 A

215835_at 949 SCARB AV70813 3.43 29.06 3.53 0.12 3.43 12.10 6.25 0.52 209047_at 358 AQP1 AL51839 129.69 1090.70 133.76 0.12 129.69 307.48 190.88 0.62 214502_at 8970 HIST1 NM_0210 2.75 13.12 1.61 0.12 2.75 3.00 1.94 216447_at AK02452 1.80 19.69 2.43 0.12 1.80 3.39 14.05 208533_at 6656 SOX1 NM_0059 5.71 17.16 2.12 0.12 5.71 1.80 2.81 216363 at S73614 26.46 66.54 8.24 0.12 26.46 30.88 21.77 218656_s_at 10186 LHFP NM_0057 4.45 22.24 2.77 0.12 4.45 2.79 2.51 211920_at 629 CFB AF34967 3.25 36.01 4.50 0.12 3.25 32.91 3.67 0.11 202086_at 4599 MX1 NM_0024 306.62 3062.73 389.68 0.13 306.62 4083.25 648.81 0.16 220228_at 23431 AP4E1 AB03065 4.96 20.77 2.65 0.13 4.96 2.35 1.31 211164 at 2042 EPHA3 AF21346 1.05 18.86 2.44 0.13 1.05 2.42 2.73 216687_x_at 7366 UGT2B U06641 8.05 24.52 3.19 0.13 8.05 17.44 8.77 0.50 220226_at 79054 TRPM8 NM_0240 20.22 56.93 7.45 0.13 20.22 14.18 23.50 208143_s_at 10876 FAM12 NM_0066 2.76 29.14 3.83 0.13 2.76 4.52 1.82 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 214939_x_at 4301 MLLT4 AB01139 10.19 16.08 2.12 0.13 10.19 9.34 14.66 205106_at 4515 MTCP1 NM_0142 37.46 59.04 7.79 0.13 37.46 24.53 33.09 214966_at 2901 GRIK5 S40369 3.18 25.09 3.33 0.13 3.18 9.21 9.25 212224_at 216 ALDH1 NM_0006 15.84 54.38 7.21 0.13 15.84 43.36 21.96 0.51 Al 89 219456_s_at 79890 RIN3 NM_0248 70.81 145.86 19.38 0.13 70.81 54.48 15.97 217706_at 220074 LRRC5 AV74201 7.83 42.90 5.71 0.13 7.83 14.82 10.49 0.71 211745_x_at 3039 HBA1 BC00593 19.64 60.30 8.12 0.13 19.64 4.91 19.30 221186_at NM_0251 14.39 36.10 4.87 0.13 14.39 9.20 6.91 213973_at 6238 RRBP1 BE64639 36.16 80.15 10.89 0.14 36.16 27.42 29.48 209763_at 91851 CHRD AL04917 6.88 29.60 4.05 0.14 6.88 18.04 25.39 220556_at 23439 ATP1B NM_0120 4.40 21.10 2.91 0.14 4.40 9.06 8.98 203930_s_at 4137 MAPT NM_0168 3.50 24.27 3.35 0.14 3.50 13.37 21.10 210354_at 3458 IFNG M29383 3.80 24.89 3.46 0.14 3.80 7.75 8.95 217316_at 390892 OR7A1 AO00525 4.05 35.52 4.95 0.14 4.05 8.15 2.83 205772_s_at 9465 AKAP7 NM_0048 20.57 38.43 5.41 0.14 20.57 23.89 14.88 214837_at 213 ALB M12523 9.90 33.25 4.69 0.14 9.90 19.48 7.07 0.36 207580 at 4115 MAGE NM 0023 5.24 15.23 2.15 0.14 5.24 10.97 14.43 220491_at 57817 HAMP NM_0211 26.85 58.18 8.26 0.14 26.85 44.03 38.80 213722_at 6657 SOX2 AW00716 2.54 17.20 2.45 0.14 2.54 6.29 8.45 220568_at NM_0185 13.19 20.61 2.93 0.14 13.19 4.49 2.79 206071 s at 2042 EPHA3 AF21345 1.38 26.66 3.79 0.14 1.38 2.36 18.60 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 210579_s_at 10107 TRIM1 AF22012 8.29 54.23 7.75 0.14 8.29 48.81 49.49 204439_at 10964 1F144L NM_0068 62.17 663.59 94.85 0.14 62.17 681.10 109.27 0.16 207242_s_at 2897 GRIK1 NM_0008 3.57 36.81 5.26 0.14 3.57 8.45 7.77 211472_at 23654 PLXNB AF33679 4.02 17.27 2.47 0.14 4.02 5.62 1.89 212750_at 26051 PPP1R1 AB02063 6.69 28.07 4.05 0.14 6.69 19.11 10.07 0.53 209597_s_at 10687 PNMA AB02069 21.05 41.90 6.05 0.14 21.05 15.98 6.85 203838_s_at 10188 TNK2 A1146308 37.41 91.12 13.18 0.14 37.41 33.55 15.37 210086_at 55806 HR AF03919 6.55 19.01 2.75 0.14 6.55 18.18 11.24 0.62 208514_at 3753 KCNE1 NM_0002 3.98 16.90 2.45 0.15 3.98 3.92 12.77 214772_at 25758 Cllorf4 H08993 6.82 27.01 3.95 0.15 6.82 12.77 31.78 204667_at 3169 FOXA1 NM_0044 3.55 46.41 6.86 0.15 3.55 26.09 19.78 205388_at 7125 TNNC2 NM 0032 11.77 41.53 6.15 0.15 11.77 15.33 9.57 206749_at 910 CD1B NM_0017 11.77 27.68 4.12 0.15 11.77 10.87 13.60 221697_at 440738 MAP1L AF27665 6.23 22.08 3.29 0.15 6.23 8.08 16.92 218644_at 26499 PLEK2 NM_0164 63.35 140.84 21.03 0.15 63.35 100.88 95.53 214067_at 115939 C16orf4 AL03170 4.09 21.02 3.14 0.15 4.09 8.77 13.53 207393_at 3062 HCRTR NM_0015 17.49 33.30 5.03 0.15 17.49 4.39 6.84 208422_at 4481 MSR1 NM_0024 2.61 11.37 1.73 0.15 2.61 12.31 5.96 0.48 207587_at 1418 CRYG NM0146 4.73 30.31 4.61 0.15 4.73 2.50 16.76 219764 at 11211 FZD10 NM 0071 7.21 14.71 2.24 0.15 7.21 8.61 5.14 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 216193_at 440366 LOC44 X69637 7.02 25.01 3.82 0.15 7.02 22.40 27.45 211227_s_at 730420 PCDH1 AF33221 12.95 25.45 3.90 0.15 12.95 27.12 24.97 216418 at 215 /// ABCD1 AL13317 7.45 28.01 4.30 0.15 7.45 14.65 21.25 207293_s_at 186 AGTR2 U16957 2.10 15.75 2.44 0.15 2.10 2.90 4.52 206347_at 5165 PDK3 NM_0053 40.62 80.76 12.54 0.16 40.62 35.91 44.38 221420_at NM_0051 5.63 10.20 1.59 0.16 5.63 6.22 1.92 221140_s_at 29933 GPR13 NM_0133 36.52 92.14 14.42 0.16 36.52 66.33 203.99 208401_s_at 2740 GLP1R U01157 7.03 29.03 4.55 0.16 7.03 5.22 7.44 220854_at NM_0141 8.49 19.50 3.06 0.16 8.49 1.44 2.51 214453_s_at 10561 1F144 NM_0064 79.18 689.10 108.37 0.16 79.18 632.18 153.77 0.24 219285_s_at 51199 NIN NM_0163 2.10 14.68 2.33 0.16 2.10 4.65 4.66 204856_at 10331 B3GNT NM_0142 13.44 40.89 6.50 0.16 13.44 24.93 13.30 0.53 216171_at 1937 EEF1G AK02527 1.35 11.26 1.80 0.16 1.35 1.73 5.26 209915_s_at 9378 NRXN1 AB03535 3.74 20.28 3.24 0.16 3.74 2.16 5.72 208226_x_at 53616 ADAM NM_0041 13.66 24.39 3.90 0.16 13.66 21.56 11.11 0.52 208032_s_at 2892 GRIA3 NM_0008 2.63 18.61 2.98 0.16 2.63 5.72 2.65 203587_at 379 ARL4D U25771 9.71 26.35 4.24 0.16 9.71 10.06 9.08 205108 s at 338 APOB NM_0003 6.65 23.09 3.73 0.16 6.65 3.21 5.11 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 206310_at 6691 SPINK NM_0211 7.24 26.12 4.22 0.16 7.24 15.04 8.47 0.56 211480_s_at 6579 SLCO1 AF08522 2.65 10.98 1.79 0.16 2.65 3.01 2.98 210614_at 7274 TTPA U21938 10.55 29.37 4.79 0.16 10.55 4.37 10.08 208063_s_at 10753 CAPN9 NM_0066 7.64 35.56 5.82 0.16 7.64 9.83 5.86 210659_at 1240 CMKL U79526 7.99 59.40 9.72 0.16 7.99 18.35 17.88 208392_x_at 3431 SP110 NM_0045 83.11 293.94 48.41 0.16 83.11 280.34 21.95 0.08 206811_at 114 ADCY8 NM_0011 2.79 26.34 4.36 0.17 2.79 26.63 12.96 0.49 222362_at 3268 HRBL H07885 7.53 57.01 9.44 0.17 7.53 26.58 11.59 0.44 207206_s_at 239 ALOX1 NM_0006 14.18 43.89 7.27 0.17 14.18 12.68 7.35 201185_at 5654 HTRA1 NM_0027 6.55 41.28 6.86 0.17 6.55 5.71 23.79 220016_at 79026 AHNA NM_0240 11.01 52.73 8.79 0.17 11.01 20.63 18.55 204698_at 3669 ISG20 NM_0022 6.50 24.33 4.08 0.17 6.50 315.07 146.78 0.47 214977 at 6503 SLA AK02385 4.77 24.45 4.10 0.17 4.77 32.81 31.55 220636_at 64446 DNA12 NM_0230 8.55 46.43 7.80 0.17 8.55 14.24 5.23 0.37 207142_at 3760 KCNJ3 NM_0022 1.07 14.81 2.50 0.17 1.07 7.90 2.26 215028_at 57556 SEMA6 AB00243 5.37 13.68 2.32 0.17 5.37 5.32 31.18 215774_s_at AV65047 1.20 11.66 1.98 0.17 1.20 22.70 4.33 0.19 210182_at 1325 CORT AB00026 16.34 46.81 7.96 0.17 16.34 37.50 20.88 0.56 221151_at 56979 PRDM9 NM_0202 4.44 27.14 4.63 0.17 4.44 4.60 12.30 208606_s_at 54361 WNT4 NM_0307 3.95 20.76 3.55 0.17 3.95 6.18 6.72 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 208559_at 3651 PDX1 NM_0133 7.16 17.20 2.94 0.17 7.16 12.64 5.51 0.44 207409_at 3950 LECT2 NM_0023 7.49 15.66 2.68 0.17 7.49 6.38 1.43 203475_at 1588 CYP19 NM_0001 30.55 83.20 14.26 0.17 30.55 79.24 84.70 Al 03 216929_x_at 28 ABO U15197 17.66 37.04 6.35 0.17 17.66 36.60 10.58 0.29 216857_at L48728 36.05 57.75 9.93 0.17 36.05 11.23 35.47 210915_x_at 28568 // TRBV1 M15564 16.84 34.84 6.00 0.17 16.84 14.86 11.93 214883_at 7067 THRA X55005 4.36 19.94 3.46 0.17 4.36 4.15 7.25 209670_at 28755 TRAC M12959 51.55 212.86 36.99 0.17 51.55 68.90 29.65 204972_at 4939 OAS2 NM0168 275.77 1007.17 175.54 0.17 275.77 955.50 240.13 0.25 213630_at 23148 KIAAO AB00236 6.20 15.38 2.69 0.17 6.20 4.14 14.27 215295_at 1838 DTNB Y15718 3.32 16.46 2.88 0.17 3.32 7.02 4.89 208391_s_at 2740 GLP1R NM_0020 4.03 11.14 1.95 0.17 4.03 5.25 2.39 217705_at 5587 PRKD1 AW08517 1.71 18.82 3.31 0.18 1.71 17.69 0.89 0.05 209768_s_at 2812 /// GP1BB A1860917 13.81 37.74 6.65 0.18 13.81 4.57 8.18 SEPTS

206227_at 8483 CILP NM_0036 17.85 49.71 8.80 0.18 17.85 22.56 28.21 213004_at 23452 ANGPT A1074333 20.60 54.18 9.63 0.18 20.60 19.17 28.22 207267_s_at 53820 DSCR6 NM_0189 14.60 28.74 5.12 0.18 14.60 8.45 16.28 215478_at 9699 RIMS2 AF00715 9.55 45.67 8.16 0.18 9.55 13.17 16.35 215361_at AK02224 3.15 16.21 2.90 0.18 3.15 1.62 1.33 200939_s_at 473 RERE A1920976 3.12 14.35 2.57 0.18 3.12 5.87 2.95 207209_at 1068 CETN1 NM_0040 36.81 55.51 9.95 0.18 36.81 17.31 40.48 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 206416 at 7755 ZNF20 NM 0034 39.32 77.41 13.88 0.18 39.32 13.12 21.92 220562_at 54905 CYP2 NM_0177 37.04 73.39 13.16 0.18 37.04 29.51 31.98 216651_s_at 2572 GAD2 X69936 3.24 35.32 6.34 0.18 3.24 11.09 10.07 211198_s_at 23308 ICOSL AF28902 12.92 114.47 20.57 0.18 12.92 147.71 172.98 214393_at 8153 RND2 AI884814 8.89 40.89 7.35 0.18 8.89 17.19 21.45 215703_at 1080 CFTR W60595 13.92 38.36 6.89 0.18 13.92 18.69 15.56 210199_at 1409 CRYA U66584 12.28 34.91 6.28 0.18 12.28 24.91 20.91 A

203084_at 7040 TGFB1 NM_0006 41.41 91.16 16.41 0.18 41.41 38.49 11.22 216790_at 9154 SLC28 AK02646 6.42 23.05 4.15 0.18 6.42 16.15 10.52 0.65 Al 5 209277_at 7980 TFPI2 AL57409 5.96 13.68 2.47 0.18 5.96 164.41 445.38 221292_at 8643 PTCH2 NM_0037 21.02 36.76 6.63 0.18 21.02 7.94 18.39 207542_s_at 358 AQP1 NM_0003 78.24 562.65 101.82 0.18 78.24 138.56 121.71 216805_at 50807 DDEF1 AK02725 2.26 24.10 4.36 0.18 2.26 15.19 13.08 210008_s_at 6183 MRPS1 BO00161 38.78 84.69 15.34 0.18 38.78 73.25 59.12 220559_at 2019 EN1 NM0014 12.44 20.59 3.73 0.18 12.44 10.77 13.77 222328_x_at 55384 MEG3 AI133721 7.82 30.86 5.63 0.18 7.82 4.12 10.67 213537_at 3113 HLA- AI128225 7.89 14.48 2.65 0.18 7.89 15.62 12.45 216314_at 167 CRISPI X95238 2.14 14.60 2.68 0.18 2.14 2.81 1.09 203131_at 5156 PDGFR NM_0062 7.99 16.02 2.95 0.18 7.99 6.21 11.43 210569_s_at 27180 SIGLE AF24718 20.09 32.10 5.92 0.18 20.09 4.65 12.82 206596_s_at 4901 NRL M81840 5.03 40.72 7.52 0.18 5.03 3.10 10.56 203888 at 7056 THBD NM 0003 399.76 963.86 179.21 0.19 399.76 1715.58 491.61 0.29 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (10ng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (10ng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 216821_at 149501 KRT8 AL13706 19.09 54.43 10.13 0.19 19.09 24.72 17.91 205840_x_at 2688 GH1 NM_0005 4.95 17.81 3.32 0.19 4.95 13.28 14.15 215941_at D16471 4.71 19.57 3.65 0.19 4.71 1.92 5.43 206242_at 9032 TM4SF NM_0039 8.09 19.69 3.69 0.19 8.09 11.08 7.52 209752_at 5967 REG1A AF17233 3.75 23.56 4.42 0.19 3.75 3.67 3.30 206454_s_at 6010 RHO AA05883 8.78 41.48 7.80 0.19 8.78 17.96 3.50 0.19 208007_at NM 0121 15.22 23.18 4.37 0.19 15.22 4.61 16.67 221438_s_at 56158 TEX12 NM_0312 3.55 11.57 2.18 0.19 3.55 11.24 6.70 0.60 203887_s_at 7056 THBD NM_0003 729.02 1651.91 312.45 0.19 729.02 3541.42 894.93 0.25 215226_at 23086 EXPHS AK00078 14.05 34.33 6.51 0.19 14.05 4.96 13.74 221183_at NM 0250 1.53 16.94 3.21 0.19 1.53 1.83 4.94 214385_s_at 4586 /// MUCS A1521646 2.20 22.52 4.28 0.19 2.20 9.30 2.79 AC ///

216690_at 26664 OR7C1 A000525 3.57 21.89 4.16 0.19 3.57 5.94 8.16 222224_at 342538 NACA AJ278883 19.79 36.46 6.93 0.19 19.79 9.71 4.58 L

203009_at 4059 BCAM NM_0055 18.07 55.85 10.62 0.19 18.07 29.07 15.04 0.52 207578_s_at 3360 HTR4 NM_0008 29.50 172.70 32.87 0.19 29.50 47.16 57.22 220373_at 54798 DCHS2 NM_0176 3.99 14.50 2.77 0.19 3.99 5.26 3.45 216708 x at 3535 IGL @ D84143 11.02 29.20 5.57 0.19 11.02 8.06 7.85 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (10ng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (10ng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 219103_at 55616 DDEFL NM_0177 14.17 78.77 15.03 0.19 14.17 27.58 5.68 0.21 205266_at 3976 LIE NM_0023 14.44 39.25 7.51 0.19 14.44 61.96 121.11 220535_at 55138 FAM90 NM_0180 10.39 26.78 5.12 0.19 10.39 7.43 2.73 Al 88 205552_s_at 4938 OAS1 NM_0025 137.96 744.19 142.55 0.19 137.96 363.07 107.94 0.30 216709_at 400655 LOC40 AL16204 9.34 36.70 7.03 0.19 9.34 7.20 7.33 204684_at 4884 NPTX1 NM_0025 64.95 318.61 61.26 0.19 64.95 1104.38 533.67 0.48 215534 at AL11754 17.98 56.95 11.02 0.19 17.98 60.54 14.84 0.25 210454_s_at 3763 KCNJ6 U24660 7.82 23.44 4.55 0.19 7.82 36.83 5.96 0.16 216722 at 139538 VENT AF16496 3.43 17.55 3.41 0.19 3.43 25.00 5.14 0.21 216626_at AL05002 6.50 22.14 4.31 0.19 6.50 9.22 6.38 211602_s_at 7220 TRPC1 U31110 21.05 39.13 7.65 0.20 21.05 5.40 24.02 203325_s_at 1289 COLSA A1130969 8.42 13.96 2.73 0.20 8.42 8.56 2.05 202869_at 4938 OAS1 NM_0168 165.01 762.84 149.48 0.20 165.01 722.61 133.48 0.18 217232_x_at 3043 HBB AF05918 26.73 55.35 10.85 0.20 26.73 35.18 74.89 207193_at 181 AGRP NM_0011 10.75 46.71 9.17 0.20 10.75 17.91 16.59 213541_s_at 2078 ERG A1351043 4.58 33.06 6.49 0.20 4.58 23.23 30.75 206155_at 1244 ABCC2 NM_0003 2.30 10.16 2.00 0.20 2.30 10.86 6.30 0.58 209559_at 9026 HIP1R AB01338 12.55 50.86 10.02 0.20 12.55 13.89 5.17 207944_at 4951 0CM NM_0061 10.46 32.47 6.40 0.20 10.46 5.00 5.29 207368_at 3352 HTR1D NM_0008 1.23 37.50 7.40 0.20 1.23 4.58 13.42 216875 x at 55547 HAB1 X83412 18.50 33.24 6.57 0.20 18.50 20.61 24.45 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 202458_at 11098 PRSS23 NM_0071 15.23 45.10 8.91 0.20 15.23 157.75 161.56 207460_at 3004 GZMM NM_0053 15.65 38.99 7.71 0.20 15.65 12.47 8.42 211608_at U50073 3.99 26.51 5.26 0.20 3.99 20.38 4.28 0.21 204851_s_at 1641 DCX BE55135 2.49 15.40 3.06 0.20 2.49 2.96 3.78 214461 at 3929 LBP NM0041 4.72 13.83 2.75 0.20 4.72 2.55 4.53 221409_at 56656 OR2S2 NM_0198 16.57 44.94 8.94 0.20 16.57 44.62 17.53 0.39 204395_s_at 2869 GRKS NM_0053 4.85 39.76 7.93 0.20 4.85 13.18 3.49 0.26 206795_at 2151 F2RL2 NM_0041 5.69 24.09 4.81 0.20 5.69 11.45 1.02 0.09 205495_s_at 10578 GNLY NM_0064 20.35 49.27 9.84 0.20 20.35 3.70 5.10 219514_at 23452 ANGPT NM_0120 5.02 35.13 7.02 0.20 5.02 13.05 4.40 0.34 220142_at 60484 HAPLN NM_0218 25.08 49.29 9.85 0.20 25.08 14.99 21.25 208181_at 8365 HIST1 NM_0035 1.92 18.25 3.65 0.20 1.92 2.67 15.62 203596_s_at 24138 WITS NM_0124 8.22 53.28 10.67 0.20 8.22 91.58 20.13 0.22 206883xat 2815 GP9 NM0001 44.47 74.63 14.96 0.20 44.47 20.41 8.43 206856_at 10990 LILRB NM_0068 6.75 16.31 3.28 0.20 6.75 7.61 12.82 207349_s_at 7352 UCP3 NM 0228 18.73 84.10 16.96 0.20 18.73 27.32 31.07 207638_at 5651 PRSS7 NM_0027 0.46 10.71 2.16 0.20 0.46 6.15 3.29 208285_at 26659 OR7A5 NM_0175 8.56 27.54 5.59 0.20 8.56 3.30 2.75 214059_at 10561 IF144 BE04943 26.82 109.98 22.31 0.20 26.82 80.13 40.28 0.50 216854_at 10220 GDF11 AF02833 6.73 10.80 2.19 0.20 6.73 11.00 4.64 0.42 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 208281_x_at 1617 /// DAZ1 NM_0203 4.25 41.71 8.50 0.20 4.25 32.65 12.54 0.38 DAZ
216487_at 3709 ITPR2 AL04998 4.02 13.51 2.76 0.20 4.02 2.23 3.70 221149_at 27202 GPR77 NM_0184 2.75 25.88 5.30 0.20 2.75 51.40 37.04 0.72 207342_at 1258 CNGB1 NM_0012 3.35 11.94 2.45 0.20 3.35 3.50 2.02 218400_at 4940 OAS3 NM_0061 193.77 989.10 203.04 0.21 193.77 715.99 284.58 0.40 220531_at 79907 FLJ141 NM_0248 3.50 13.61 2.80 0.21 3.50 4.45 3.32 211103_at 4647 MYO7 U55209 10.66 36.22 7.46 0.21 10.66 5.69 8.66 A

207569_at 6098 ROS1 NM_0029 13.54 40.21 8.28 0.21 13.54 10.51 13.64 209992_at 5208 PFKFB AB04480 6.22 31.87 6.57 0.21 6.22 6.47 14.75 207774 at 83734 ATG10 NM 0250 27.24 59.76 12.34 0.21 27.24 18.31 35.76 211606 at U43279 3.75 14.10 2.92 0.21 3.75 10.14 5.37 0.53 203842_s_at 22924 MAPR NM_0123 8.33 26.12 5.40 0.21 8.33 18.46 7.12 0.39 220534_at 79097 TRIM4 NM_0241 22.18 44.07 9.13 0.21 22.18 33.60 12.66 0.38 214376 at A1263044 6.65 12.21 2.53 0.21 6.65 11.63 13.39 205506 at 7429 VIL1 NM0071 2.43 11.39 2.37 0.21 2.43 1.70 12.49 219153_s_at 79875 THSD4 BG16347 9.93 37.84 7.87 0.21 9.93 12.52 11.53 208448xat 3449 IFNA16 NM0021 17.33 36.83 7.67 0.21 17.33 11.22 7.85 206343_s_at 3084 NRG1 NM_0139 3.46 11.68 2.45 0.21 3.46 10.32 98.74 214987 at AL04944 12.98 31.12 6.55 0.21 12.98 18.04 4.13 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 215214_at 3535 IGL@ H53689 15.76 26.23 5.52 0.21 15.76 36.35 46.53 204874_x_at 8938 BAIAP NM_0039 4.70 23.75 5.00 0.21 4.70 4.92 9.80 220245_at 51151 SLC45 NM 0161 34.04 72.99 15.37 0.21 34.04 30.18 31.16 213816_s_at 4233 MET AA00514 8.10 22.36 4.72 0.21 8.10 6.78 9.19 213955_at 91977 MYOZ BE67315 9.73 24.84 5.25 0.21 9.73 6.89 4.61 210267_at 57185 NPAL3 BC00126 5.35 35.89 7.59 0.21 5.35 14.82 15.15 203990_s_at 7403 UTX A1140752 3.30 10.49 2.23 0.21 3.30 9.39 5.38 215010_s_at 9024 BRSK2 AJ006701 10.54 37.26 7.92 0.21 10.54 2.94 3.94 220622_at 79782 LRRC3 NM_0247 3.02 10.62 2.26 0.21 3.02 13.15 10.31 40524_at 11099 PTPN2 X79510 4.73 22.60 4.81 0.21 4.73 25.76 35.61 205539_at 10677 AVIL NM_0065 33.26 52.80 11.24 0.21 33.26 22.28 22.23 214498 at 434 ASIP NM 0016 2.35 17.56 3.75 0.21 2.35 18.51 4.35 0.23 208168_s_at 1118 CHIT1 NM_0034 5.09 15.71 3.36 0.21 5.09 3.62 2.89 214200_s_at 1291 COL6A A1193744 4.27 25.62 5.49 0.21 4.27 25.50 7.40 0.29 214947_at AF05214 173.91 458.82 98.30 0.21 173.91 100.82 30.97 220957_at 64693 CTAGE NM_0226 10.02 46.85 10.10 0.22 10.02 15.60 18.19 216472_at 6453 ITSN1 AF00373 8.07 52.67 11.39 0.22 8.07 25.37 37.51 213905xat 10194 // BGN /// AA84525 3.46 15.70 3.39 0.22 3.46 12.08 19.73 204845_s_at 2028 ENPEP NM_0019 3.08 12.61 2.73 0.22 3.08 2.76 1.73 211442xat 64816 CYP3A AF28011 6.49 24.68 5.34 0.22 6.49 6.58 5.42 202997s at 4017 LOXL2 BE25121 3.18 10.97 2.38 0.22 3.18 3.93 3.30 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (10ng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (10ng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 216612_x_at AK02198 8.07 18.70 4.07 0.22 8.07 12.79 21.33 219211_at 11274 // USP18 NM 0174 108.73 392.94 85.42 0.22 108.73 273.28 66.66 0.24 222178sat AL13326 3.73 10.55 2.30 0.22 3.73 1.64 3.70 204870_s_at 5126 PCSK2 NM_0025 12.30 33.16 7.22 0.22 12.30 13.17 5.12 211832_s_at 4193 MDM2 AF20137 11.58 20.16 4.40 0.22 11.58 33.23 25.55 221342_at 80739 C6orf25 NM_0252 8.88 28.62 6.26 0.22 8.88 4.78 13.74 201438_at 1293 COL6A NM_0043 7.30 11.62 2.55 0.22 7.30 6.17 5.79 206455_s_at 6010 RHO NM_0005 21.22 38.08 8.36 0.22 21.22 41.58 10.28 0.25 208020_s_at 775 CACN NM_0007 8.53 22.08 4.85 0.22 8.53 3.30 13.32 222254 at AL03442 4.11 16.86 3.70 0.22 4.11 2.65 5.24 208219_at 91 ACVR1 NM_0203 8.45 45.25 9.95 0.22 8.45 18.74 12.83 0.68 208208_at 8735 MYH13 NM_0038 6.15 37.65 8.29 0.22 6.15 4.01 17.13 209159_s_at 65009 NDRG4 AV72421 8.20 70.63 15.63 0.22 8.20 10.61 9.35 208545_x_at 6874 TAF4 NM_0031 28.98 44.60 9.88 0.22 28.98 20.75 22.09 217490 at AL04930 11.98 47.84 10.61 0.22 11.98 21.29 23.32 205914_s_at 2902 /// GRIN1 D13515 4.39 11.05 2.47 0.22 4.39 9.71 9.90 207034_s_at 2736 GL12 NM_0303 3.03 37.90 8.46 0.22 3.03 2.71 4.92 205018 s at 10150 MBNL NM 0057 4.63 18.46 4.14 0.22 4.63 16.00 5.20 0.33 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (10ng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (10ng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 207420_at 10584 COLEC NM 0064 8.48 14.72 3.30 0.22 8.48 11.84 3.45 217236_x_at 3500 IGHG1 S74639 4.47 60.17 13.48 0.22 4.47 25.60 30.56 214492_at 6444 SGCD NM_0003 3.20 23.26 5.24 0.23 3.20 9.28 22.52 207151_at 117 ADCY NM_0011 24.36 39.56 8.96 0.23 24.36 11.34 11.52 202270_at 2633 GBP1 NM_0020 3.58 17.81 4.03 0.23 3.58 7.29 7.94 204802_at 6236 RRAD NM_0041 1.53 77.18 17.53 0.23 1.53 249.55 639.77 216245 at 3557 IL1RN BE56344 4.56 23.85 5.42 0.23 4.56 6.81 25.37 210159_s_at 11074 TRIM3 AF23038 8.30 24.94 5.69 0.23 8.30 11.07 9.49 209850_s_at 10435 CDC42 B000540 22.00 71.03 16.22 0.23 22.00 32.79 21.64 217428_s_at 1300 COL10 X98568 6.56 20.03 4.59 0.23 6.56 4.20 5.81 Al 206975_at 4049 LTA NM_0005 3.72 18.73 4.30 0.23 3.72 58.43 26.95 0.46 212821_at 26030 PLEKH A1738980 29.35 93.51 21.47 0.23 29.35 7.41 27.90 215076_s_at 1281 COL3A AU14416 5.45 11.08 2.55 0.23 5.45 29.13 8.76 0.30 219761 at 51267 CLEC1 NM 0165 12.48 37.32 8.57 0.23 12.48 30.77 14.58 0.47 214324 at 2813 GP2 BF22248 13.12 24.61 5.66 0.23 13.12 7.42 4.76 218186_at 57111 RAB25 NM_0203 4.04 10.27 2.36 0.23 4.04 5.81 5.61 211169_s_at 5506 PPP1R3 AF02457 4.63 16.00 3.69 0.23 4.63 15.83 13.96 209013_x_at 7204 TRIO AF09139 12.35 18.84 4.35 0.23 12.35 9.26 8.74 217688 at AA22444 3.53 29.19 6.75 0.23 3.53 2.54 5.29 207737 at NM 0219 6.02 20.00 4.63 0.23 6.02 16.27 2.37 0.15 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 206372_at 4618 MYF6 NM_0024 7.85 29.22 6.77 0.23 7.85 6.07 3.02 214604_at 3237 HOXD NM_0211 3.35 19.53 4.53 0.23 3.35 19.69 11.06 0.56 207978_s_at 8013 NR4A3 NM_0069 6.57 62.28 14.50 0.23 6.57 139.87 137.78 216581 at 441133 LOC44 AL02206 3.70 33.06 7.71 0.23 3.70 8.64 4.16 207656_s_at 51 ACOX1 NM_0040 3.97 18.29 4.27 0.23 3.97 6.86 3.38 221914_at 6853 SYN1 H19843 4.35 24.00 5.60 0.23 4.35 7.60 6.39 212489_at 1289 COLSA A1983428 2.67 13.99 3.28 0.23 2.67 8.97 15.19 209789_at 10391 CORO2 BF93964 11.86 20.38 4.78 0.23 11.86 32.55 7.48 0.23 208253 at 27181 SIGLE NM0144 7.55 25.65 6.04 0.24 7.55 2.42 24.75 201235_s_at 7832 BTG2 BG33906 110.45 1093.07 257.99 0.24 110.45 709.50 1467.85 215901 at 347344 ZNF81 X68011 5.87 34.73 8.20 0.24 5.87 3.30 10.64 220289sat 55057 // AIM 1L NM 0179 7.82 13.51 3.19 0.24 7.82 4.11 6.45 217160_at 7258 TSPY1 M94893 3.58 13.64 3.22 0.24 3.58 4.89 5.05 207427 at 49 ACR NM0010 3.24 16.20 3.84 0.24 3.24 8.57 4.94 219364_at 79132 LGP2 NM_0241 12.91 56.98 13.50 0.24 12.91 36.47 9.26 0.25 210880_s_at 10278 EFS AB00146 11.19 35.86 8.50 0.24 11.19 2.73 20.70 214490 at 416 ARSF NM 0040 17.84 35.68 8.48 0.24 17.84 17.39 10.11 214799_at 23114 NFASC A1821777 5.41 17.95 4.27 0.24 5.41 3.82 2.01 207114_at 80740 LY6G6 NM 0252 14.12 36.43 8.66 0.24 14.12 47.18 31.42 0.67 207900 at 6361 CCL17 NM_0029 3.85 21.82 5.19 0.24 3.85 22.03 36.17 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 207690 at 257 ALX3 NM 0064 11.07 18.24 4.34 0.24 11.07 7.42 9.50 209671xat 28755 // TRA@ M12423 24.38 104.03 24.78 0.24 24.38 17.84 13.99 TRAC

207110_at 3768 KCNJ1 NM_0210 6.09 12.02 2.87 0.24 6.09 3.06 2.22 217275_at L77565 13.24 40.54 9.67 0.24 13.24 10.39 10.70 205261_at 5225 PGC NM_0026 33.37 62.29 14.92 0.24 33.37 61.82 39.44 0.64 206123_at 3996 LLGL1 D50550 17.03 44.07 10.59 0.24 17.03 8.65 22.49 215647_at 64062 RBM26 AK02157 0.35 16.36 3.94 0.24 0.35 8.09 2.65 203868_s_at 7412 VCAM NM_0010 8.54 412.52 99.55 0.24 8.54 498.26 82.10 0.16 217660_at 79784 MYH14 AW18821 3.59 17.44 4.22 0.24 3.59 11.95 20.39 205998_x_at 1576 CYP3A NM_0174 81.17 152.61 37.01 0.24 81.17 99.79 134.07 220158_at 56891 LGALS NM_0201 23.45 37.04 8.99 0.24 23.45 43.75 15.17 0.35 216312_at 492 ATP2B AW61561 12.39 26.54 6.45 0.24 12.39 34.49 5.68 0.16 217334_at 442186 OR2J3 AL02272 7.41 13.17 3.20 0.24 7.41 2.84 2.97 208142_at 10876 FAM12 NM 0066 6.33 10.44 2.54 0.24 6.33 4.73 2.79 210684_s_at 1742 DLG4 AF02882 9.47 40.37 9.83 0.24 9.47 9.74 17.94 48031rat 10826 C5orf4 H93077 12.87 28.02 6.84 0.24 12.87 15.35 17.71 220639_at 79853 TM4SF NM_0247 8.65 14.86 3.63 0.24 8.65 12.17 2.57 204912_at 3587 IL10RA NM_0015 460.98 2093.69 512.21 0.24 460.98 3175.53 1078.66 0.34 215063_x_at 55631 LRRC4 AL39014 127.53 218.71 53.60 0.25 127.53 332.09 119.06 0.36 219416_at 51435 SCARA NM_0162 20.83 44.03 10.82 0.25 20.83 29.92 31.71 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 204018_x_at 3039 /// HBA1 NM_0005 26.22 50.79 12.49 0.25 26.22 11.05 11.47 221170_at 59340 HRH4 AF31223 8.58 15.44 3.80 0.25 8.58 7.70 6.49 211640_x_at 4917 NTN2L L23519 3.85 10.12 2.49 0.25 3.85 3.25 3.96 207434_s_at 4151 /// FXYD2 NM 0216 15.62 28.70 7.07 0.25 15.62 75.78 12.35 0.16 207967 at 11311 VPS45 NM 0072 14.12 49.68 12.26 0.25 14.12 9.45 15.67 214228_x_at 7293 TNFRS AJ277151 2.59 13.05 3.22 0.25 2.59 215.37 126.68 0.59 205483_s_at 9636 ISG15 NM_0051 404.40 2028.75 501.75 0.25 404.40 1879.17 752.00 0.40 202335_s_at 7320 UBE2B NM_0033 27.08 65.10 16.12 0.25 27.08 33.41 25.60 214720_x_at 151011 10-Sep BF98164 5.14 16.24 4.02 0.25 5.14 1.41 5.50 211046_at 81033 KCNH6 BC00633 8.79 18.09 4.49 0.25 8.79 6.46 19.86 204237_at 51454 GULP1 NM_0163 5.54 11.53 2.86 0.25 5.54 66.23 15.16 0.23 203153_at 3434 IFIT1 NM 0015 48.44 560.68 139.17 0.25 48.44 703.99 149.53 0.21 201374_x_at 5516 PPP2C A1379894 30.08 48.17 11.97 0.25 30.08 27.87 30.29 B

215815_at 8896 BUD31 AK00161 6.09 18.48 4.60 0.25 6.09 5.89 3.75 215658_at AK02489 2.77 12.42 3.09 0.25 2.77 4.54 7.99 211157 at AF11987 13.22 31.90 7.94 0.25 13.22 15.37 10.23 217257 at L37198 37.87 76.37 19.04 0.25 37.87 81.33 48.87 0.60 214400_at 3640 INSL3 A1991694 8.68 19.24 4.80 0.25 8.68 14.49 10.55 0.73 206318_at 57119 SPINL NM0203 11.11 35.45 8.85 0.25 11.11 14.15 21.68 211670xat 10214 SSX3 S82471 5.16 25.54 6.41 0.25 5.16 5.96 6.45 221091 at 10022 INSLS NM 0054 17.80 41.97 10.54 0.25 17.80 15.50 12.30 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (10ng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (10ng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 208111_at 554 AVPR2 NM_0000 7.29 11.61 2.92 0.25 7.29 12.39 6.95 0.56 207144sat 4435 CITED NM 0041 4.42 17.74 4.47 0.25 4.42 5.58 6.42 205216_s_at 350 APOH NM_0000 27.83 42.62 10.75 0.25 27.83 8.56 4.24 208372_s_at 3984 LIMK1 AF13437 31.95 67.95 17.21 0.25 31.95 9.65 11.98 207562_at 1609 DGKQ NM_0013 42.97 76.12 19.32 0.25 42.97 55.44 30.29 217110sat 4585 MUC4 AJ242547 8.32 17.23 4.37 0.25 8.32 9.78 3.27 221331_x_at 1493 CTLA4 NM_0052 6.30 33.90 8.63 0.25 6.30 37.21 27.95 221033_s_at 56163 RNF17 NM_0312 12.15 41.60 10.59 0.25 12.15 20.10 3.46 0.17 219962 at 59272 ACE2 NM0218 4.67 23.24 5.92 0.25 4.67 4.18 4.42 216734_s_at 643 BLR1 X68829 4.22 15.67 4.00 0.26 4.22 4.65 3.90 206000_at 4224 MEP1A NM_0055 4.05 11.34 2.90 0.26 4.05 58.09 8.08 0.14 215240_at 3690 ITGB3 A1189839 5.55 10.32 2.64 0.26 5.55 4.29 2.77 217545_at 79784 MYH14 AW08182 3.56 17.60 4.50 0.26 3.56 5.91 4.04 210745 at 3175 ONEC U96173 9.74 34.52 8.83 0.26 9.74 10.51 4.19 215304_at 79875 THSD4 U79293 11.88 45.27 11.60 0.26 11.88 13.82 3.30 217004_s_at 4168 MCF2 X13230 10.93 16.91 4.36 0.26 10.93 5.96 13.11 220469_at 11316 COPE NM_0250 42.07 70.79 18.26 0.26 42.07 19.49 46.10 204626_s_at 3690 ITGB3 NM_0002 9.87 32.67 8.44 0.26 9.87 17.27 15.12 210085sat 8416 ANXA AF23092 4.13 33.94 8.77 0.26 4.13 5.88 8.34 220426_at 79025 C20orfl NM_0240 4.76 26.95 6.99 0.26 4.76 5.32 9.25 209793_at 2890 /// GRIA1 AL56730 8.25 12.69 3.29 0.26 8.25 8.24 6.30 ///

EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 204964_s_at 8082 SSPN AL13675 21.60 41.58 10.80 0.26 21.60 13.29 9.02 210855_at 9687 GREB1 AF24539 10.75 36.31 9.44 0.26 10.75 31.19 26.24 206602_s_at 3232 HOXD NM_0068 1.77 26.94 7.01 0.26 1.77 7.43 13.58 209855_s_at 3817 KLK2 AF18874 6.04 17.55 4.57 0.26 6.04 4.04 6.82 213230_at 30850 CDR2L A1422335 6.04 39.05 10.22 0.26 6.04 8.31 18.48 221852_at 408050 NOMO N39536 5.97 13.72 3.59 0.26 5.97 3.18 7.85 213345 at 4776 NFATC A1624015 19.25 37.51 9.85 0.26 19.25 9.45 8.72 206400_at 3963 LGALS NM_0023 6.36 12.72 3.35 0.26 6.36 3.16 11.72 205348_s_at 1780 DYNC1 NM_0044 15.06 26.79 7.07 0.26 15.06 18.00 10.60 206236_at 2828 GPR4 NM_0052 19.98 33.35 8.80 0.26 19.98 25.16 11.68 207208_at 27288 HNRN NM_0144 5.85 22.13 5.86 0.26 5.85 6.03 5.70 210194_at 22925 PLA2R U17033 5.57 14.96 3.96 0.26 5.57 3.92 24.25 212325_at 22998 DKFZP AK02681 5.01 23.44 6.22 0.27 5.01 9.76 7.99 203784_s_at 55794 DDX28 BG47750 33.90 72.78 19.33 0.27 33.90 6.27 38.39 205867 at 5781 PTPN1 NM 0028 47.50 72.17 19.18 0.27 47.50 40.31 33.13 208387_s_at 10893 MMP24 NM_0066 24.00 41.40 11.02 0.27 24.00 26.02 8.45 207126_x_at 54657 UGT1A NM_0004 15.67 39.52 10.53 0.27 15.67 52.15 34.28 0.66 210179_at 3769 KCNJ1 AJ007557 4.20 20.78 5.55 0.27 4.20 20.00 3.32 0.17 220809_at 79972 FLJ143 NM_0249 20.37 34.48 9.22 0.27 20.37 20.89 24.91 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 207398_at 3239 HOXD NM_0005 6.42 22.14 5.92 0.27 6.42 3.22 6.10 206271_at 7098 TLR3 NM_0032 7.14 19.04 5.10 0.27 7.14 5.85 7.90 206051_at 1996 ELAVL NM_0219 7.51 57.30 15.37 0.27 7.51 4.90 13.20 203824_at 7103 TSPAN NM_0046 2.54 11.40 3.06 0.27 2.54 5.35 8.58 221008_s_at 64850 AGXT2 NM_0312 5.21 24.33 6.53 0.27 5.21 24.32 7.31 0.30 211008_s_at 7329 UBE2I BC00074 35.29 82.06 22.05 0.27 35.29 25.84 32.59 209761sat 3431 SP110 AA96919 422.13 1021.62 274.72 0.27 422.13 445.52 193.77 222346_at 284217 LAMA A1633741 10.50 21.15 5.69 0.27 10.50 3.99 3.35 213783_at 4242 MFNG A1760053 26.55 53.00 14.29 0.27 26.55 40.72 27.17 0.67 221295_at 1149 /// CIDEA NM_0012 5.34 47.52 12.82 0.27 5.34 11.70 6.95 0.59 219915sat 117247 SLC16 NM 0185 30.90 53.44 14.43 0.27 30.90 248.74 115.97 0.47 AlO 93 205883_at 7704 ZBTB1 NM_0060 11.54 32.27 8.72 0.27 11.54 30.38 3.64 0.12 214023xat 347733 TUBB2 AL53383 1.73 14.85 4.01 0.27 1.73 14.14 33.14 214528_s_at 7849 PAX8 NM_0139 9.12 34.34 9.29 0.27 9.12 12.86 26.81 220626_at 51156 SERPI NM_0161 7.15 25.23 6.83 0.27 7.15 11.54 28.40 220979_s_at 81849 ST6GA NM_0309 5.10 12.98 3.52 0.27 5.10 14.14 6.08 0.43 207602_at 9407 TMPRS NM_0042 32.35 56.30 15.25 0.27 32.35 46.04 25.46 216618_at AL11752 7.07 11.29 3.06 0.27 7.07 7.09 7.76 216827_at AL35537 16.94 32.06 8.69 0.27 16.94 10.81 2.25 211422_at 80036 TRPM3 AL13654 8.97 25.10 6.81 0.27 8.97 19.27 2.95 0.15 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa TMAA TMAA Control LPS TMAA TMAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 222085_at 400451 LOC40 AW45235 11.89 26.00 7.07 0.27 11.89 9.88 6.06 208006_at 2299 FOXI1 NM_0121 5.22 27.86 7.60 0.27 5.22 8.94 18.28 220131_at 53822 FXYD7 NM_0220 10.07 34.61 9.45 0.27 10.07 11.60 10.75 217222_at S74639 8.78 20.57 5.64 0.27 8.78 8.73 8.55 214762_at 534 ATP6V BF34063 25.32 44.89 12.33 0.27 25.32 18.58 14.67 210323_at 27285 TEKT2 AB03382 4.58 39.12 10.75 0.27 4.58 9.93 9.21 205666_at 2326 FMO1 NM_0020 8.79 28.09 7.73 0.28 8.79 17.62 27.75 215247_at 440895 LOC44 A1561253 30.64 60.12 16.57 0.28 30.64 21.20 15.50 213651_at 27124 PIBSPA A1935720 5.97 17.74 4.90 0.28 5.97 7.26 23.83 216946_at 3111 HLA- M29335 6.56 19.83 5.49 0.28 6.56 33.45 9.10 0.27 DOA

217479_at 388336 FLJ454 AL11020 3.67 25.71 7.16 0.28 3.67 13.97 11.27 216611_s_at 6530 SLC6A AB02284 8.07 14.18 3.95 0.28 8.07 4.91 3.85 215630_at 23180 RFTN1 AU14752 17.98 68.15 19.07 0.28 17.98 92.48 80.57 208366_at 27328 PCDH1 NM_0145 9.95 29.24 8.19 0.28 9.95 25.23 26.22 214572_s_at 3640 INSL3 NM_0055 9.53 18.33 5.14 0.28 9.53 8.07 4.02 221241sat 79370 BCL2L NM0307 4.68 15.45 4.33 0.28 4.68 8.86 2.77 204779_s_at 3217 HOXB7 NM_0045 32.81 66.69 18.71 0.28 32.81 14.88 16.60 213797_at 91543 RSAD2 A1337069 131.05 296.80 83.36 0.28 131.05 197.36 72.89 0.37 216047_x_at 23544 SEZ6L AL05025 27.19 44.58 12.53 0.28 27.19 21.70 28.99 211830_s_at 8911 CACN AF21118 21.92 52.89 14.87 0.28 21.92 68.28 53.07 All 9 220689 at NM 0180 18.47 42.63 12.00 0.28 18.47 8.81 11.09 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 202714_s_at 9692 KIAAO NM_0146 34.87 65.48 18.46 0.28 34.87 48.35 9.91 214088_s_at 2525 FUT3 AW08054 31.31 47.46 13.39 0.28 31.31 14.12 22.92 214371_at 23617 TSSK2 A1652441 23.19 40.13 11.34 0.28 23.19 4.53 9.47 216043_x_at 9727 RAB11 AK02413 46.70 88.94 25.15 0.28 46.70 33.99 37.28 208474_at 9074 CLDN6 NM_0211 13.31 35.38 10.04 0.28 13.31 16.34 26.80 207531_at 1420 CRYG NM_0209 10.18 25.54 7.26 0.28 10.18 29.22 12.39 0.42 202988_s_at 5996 RGS1 NM_0029 5.07 16.67 4.74 0.28 5.07 22.11 9.52 0.43 210248_at 7476 WNT7 D83175 5.65 22.72 6.47 0.28 5.65 7.33 25.92 A

215542_at AK02312 2.74 11.96 3.41 0.28 2.74 16.67 1.20 0.07 215857_at 56926 NCLN AK02230 5.81 23.75 6.77 0.29 5.81 17.34 5.71 0.33 207660_at 1756 DMD NM_0040 4.55 12.30 3.51 0.29 4.55 21.97 10.34 0.47 204834_at 10875 FGL2 NM_0066 235.09 447.31 128.08 0.29 235.09 443.74 52.00 0.12 217351_at 392479 LOC39 AL02445 2.40 20.21 5.80 0.29 2.40 10.45 4.22 0.40 205226_at 5157 PDGFR NM_0062 9.81 39.25 11.28 0.29 9.81 137.33 59.71 0.43 207346_at 2054 STX2 NM_0019 30.26 56.81 16.33 0.29 30.26 26.17 14.27 220817_at 7223 TRPC4 NM_0161 2.29 26.09 7.50 0.29 2.29 22.80 2.57 0.11 213592_at 187 AGTRL X89271 5.58 19.76 5.69 0.29 5.58 5.95 2.23 218523_at 64077 LHPP NM_0221 6.80 36.10 10.41 0.29 6.80 15.36 17.14 213335_s_at 10402 ST3GA AK00192 5.57 51.23 14.78 0.29 5.57 8.30 2.80 214234 s at 1577 CYP3A X90579 7.84 22.21 6.43 0.29 7.84 59.75 17.90 0.30 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 216740_at 55809 TRERF AK02485 12.83 21.32 6.18 0.29 12.83 22.35 10.56 0.47 220196_at 94025 MUC16 NM_0246 1.84 10.24 2.97 0.29 1.84 2.45 2.97 214255 at 57194 ATP10 N35112 175.94 339.96 98.64 0.29 175.94 191.53 120.37 A

217583 at 5053 PAH BG43348 3.84 22.23 6.45 0.29 3.84 4.17 2.55 221297_at 55507 GPRCS NM_0186 17.02 53.14 15.51 0.29 17.02 12.50 6.35 206404_at 2254 FGF9 NM_0020 9.63 42.36 12.37 0.29 9.63 8.19 6.64 211844sat 8828 NRP2 AF02285 2.87 16.43 4.81 0.29 2.87 15.81 41.73 221105 at NM 0183 7.33 18.28 5.35 0.29 7.33 9.13 1.94 213849_s_at 5521 PPP2R2 AA97441 27.68 76.12 22.27 0.29 27.68 29.98 23.79 209684_at 54453 RIN2 AL13692 4.45 31.01 9.08 0.29 4.45 25.64 11.26 0.44 206210_s_at 1071 CETP NM_0000 6.85 11.17 3.27 0.29 6.85 4.45 8.82 215906_at S65921 5.40 12.11 3.55 0.29 5.40 4.61 4.01 217182_at 4586 MUCS Z34282 15.36 29.14 8.54 0.29 15.36 65.91 21.97 0.33 AC

205031_at 1949 EFNB3 NM_0014 9.49 23.52 6.90 0.29 9.49 6.67 8.20 208586_s_at 548313 SSX4 NM_0056 2.43 25.54 7.50 0.29 2.43 7.83 5.05 206237_s_at 3084 NRG1 NM_0139 5.69 15.26 4.49 0.29 5.69 33.05 353.86 215184_at 23604 DAPK2 AK02680 8.52 18.96 5.59 0.29 8.52 17.70 7.18 0.41 206906_at 7087 ICAMS NM_0032 16.04 36.34 10.71 0.29 16.04 47.11 50.78 221405_at 51190 LOC51 NM_0163 17.54 27.35 8.06 0.29 17.54 11.82 8.66 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa TMAA TMAA Control LPS TMAA TMAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 210960_at 146 ADRA1 M76446 7.97 14.80 4.36 0.29 7.97 6.61 13.19 D
211193_at 8626 TP73L AF06151 17.52 34.72 10.23 0.29 17.52 13.14 22.02 213293_s_at 10346 TRIM2 AA08347 141.18 578.88 170.81 0.30 141.18 722.64 140.68 0.19 205201_at 2737 GLI3 NM_0001 39.46 86.24 25.46 0.30 39.46 52.78 75.97 204678_s_at 3775 KCNK1 U90065 1.57 12.69 3.75 0.30 1.57 6.93 14.94 217095_x_at 9437 NCR1 AJ006122 6.84 20.73 6.12 0.30 6.84 13.96 20.19 216196_at 440366 LOC44 X69637 17.85 45.99 13.63 0.30 17.85 21.40 6.17 216181_at 8871 SYNJ2 AK02675 19.40 49.75 14.77 0.30 19.40 9.21 45.08 208592_s_at 913 CD1E NM_0308 3.05 22.83 6.78 0.30 3.05 10.77 11.82 208260_at 553 AVPR1 NM_0007 31.11 52.45 15.59 0.30 31.11 24.50 15.98 221128_at 8728 ADAM NM_0230 12.63 19.33 5.75 0.30 12.63 23.18 20.16 202312_s_at 1277 COL1A K01228 14.76 27.86 8.31 0.30 14.76 18.57 19.40 215303_at BE04646 1.69 14.59 4.36 0.30 1.69 2.69 9.78 216344_at 261734 NPHP4 AL11740 8.37 29.12 8.71 0.30 8.37 20.27 20.35 216007 at 64084 CLSTN AF05217 26.37 45.13 13.51 0.30 26.37 31.45 30.75 214300_s_at 7156 TOP3A A1676092 18.81 45.26 13.55 0.30 18.81 56.78 26.21 0.46 220901_at 80045 GPR15 NM_0249 12.24 37.33 11.20 0.30 12.24 35.85 41.54 218943_s_at 23586 DDX58 NM_0143 142.59 612.93 183.90 0.30 142.59 569.23 191.35 0.34 205456_at 916 CD3E NM_0007 8.46 31.35 9.42 0.30 8.46 28.21 15.42 0.55 217474 at AL11765 20.76 33.63 10.10 0.30 20.76 15.31 41.40 210521s at 26998 FETUB AB01755 4.87 13.82 4.15 0.30 4.87 15.40 3.50 0.23 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 211896_s_at 1634 DCN AF13830 16.50 61.98 18.66 0.30 16.50 48.16 30.59 0.64 220851_at NM_0140 4.72 21.20 6.38 0.30 4.72 21.07 3.69 0.17 AFFX- 6772 STAT1 AFFX- 163.93 393.76 118.62 0.30 163.93 188.44 124.21 IM97935_5_at F3A/M97 935_5 222223_s_at 26525 IL1F5 AF21669 12.17 35.41 10.67 0.30 12.17 22.90 54.22 215651_at AK02668 23.12 78.52 23.69 0.30 23.12 13.82 16.87 207116_s_at 26330 GAPD NM_0143 4.44 15.90 4.80 0.30 4.44 16.14 11.36 0.70 211095 at 4763 NF1 D12625 12.13 24.22 7.32 0.30 12.13 25.34 19.07 213948_x_at 57863 IGSF4B A1564838 3.25 23.97 7.24 0.30 3.25 9.17 6.36 207064_s_at 314 AOC2 NM_0095 8.55 30.67 9.28 0.30 8.55 28.82 28.29 213706_at 2819 GPD1 A1368018 5.45 18.19 5.51 0.30 5.45 5.37 4.42 220129_at 54937 SOHLH NM_0178 5.02 38.90 11.79 0.30 5.02 9.76 15.42 215956_at 5868 RABSA AK02206 24.75 48.08 14.60 0.30 24.75 22.56 37.72 204562_at 3662 IRF4 NM_0024 33.88 93.40 28.43 0.30 33.88 62.68 78.51 219466_s_at 336 APOA2 NM_0016 14.30 43.55 13.26 0.30 14.30 16.43 6.18 207212_at 6550 SLC9A NM_0041 5.47 10.51 3.20 0.30 5.47 2.01 2.34 220582 at NM 0250 17.72 36.69 11.18 0.30 17.72 7.72 32.19 220687_at NM_0181 9.22 40.97 12.50 0.31 9.22 33.20 32.79 205864_at 6545 SLC7A NM_0041 26.00 48.04 14.67 0.31 26.00 17.49 9.75 207742_s_at 2649 NR6A1 NM_0014 7.62 21.90 6.69 0.31 7.62 26.80 39.67 219039 at 54910 SEMA4 NM 0177 106.17 286.50 87.50 0.31 106.17 151.64 63.78 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 208080_at 6790 AURK NM_0031 20.78 50.95 15.60 0.31 20.78 17.01 24.82 208902_s_at 256949 RPS28 BF43136 13.06 81.23 24.89 0.31 13.06 9.13 14.40 ANKR

218736_s_at 54873 PALM NM_0177 2.59 21.92 6.72 0.31 2.59 2.49 7.08 221154_at 283116 TRIM4 NM_0203 3.58 10.71 3.28 0.31 3.58 9.62 2.42 207138_at 5253 PHF2 NM_0053 2.00 10.77 3.30 0.31 2.00 9.64 6.66 215258_at 199731 IGSF4C AO00552 13.35 26.98 8.28 0.31 13.35 16.16 6.75 207907_at 8740 TNFSF NM_0038 244.50 469.67 144.24 0.31 244.50 9.70 98.35 204931_at 6943 TCF21 NM_0032 3.93 13.46 4.14 0.31 3.93 11.16 4.05 0.36 210781_x_at 2902 GRIN1 AF01573 7.99 17.08 5.25 0.31 7.99 10.02 3.25 203936_s_at 4318 MMP9 NM_0049 152.92 1272.48 391.26 0.31 152.92 1661.16 453.20 0.27 209125_at 140446 KRT6A J00269 15.03 25.14 7.74 0.31 15.03 5.22 16.94 208711_s_at 595 CCND1 BC00007 17.91 87.06 26.85 0.31 17.91 76.97 43.26 0.56 215372xat 9223 MAGI1 AU14679 20.71 77.29 23.88 0.31 20.71 28.71 3.47 201565_s_at 3398 ID2 NM_0021 2022.60 3332.02 1030.00 0.31 2022.60 5470.79 4962.34 214538_x_at 9628 RGS6 AF07392 3.00 14.82 4.58 0.31 3.00 4.90 3.30 219685_at 59353 TMEM NM_0216 1.62 22.42 6.93 0.31 1.62 4.58 7.64 215466_at AF03531 19.20 32.80 10.15 0.31 19.20 5.74 26.25 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 210699_at AF11667 10.24 45.32 14.04 0.31 10.24 46.75 6.85 0.15 220435_at 55532 SLC30 NM 0187 7.48 16.27 5.04 0.31 7.48 6.72 4.82 AlO 13 222069_s_at BF05831 3.91 14.94 4.63 0.31 3.91 6.95 8.17 208468_at 11166 SOX21 NM_0070 8.43 19.47 6.04 0.31 8.43 9.45 26.33 206996_x_at 782 CACN NM_0007 27.97 46.33 14.38 0.31 27.97 56.34 25.34 0.45 214610_at 1584 CYP11 AV70243 9.55 17.53 5.46 0.31 9.55 12.44 7.17 217651_at BF51253 12.51 35.00 10.90 0.31 12.51 8.77 18.57 210972_x_at 28517 // TRA@ M15565 12.56 32.98 10.29 0.31 12.56 10.13 23.94 206553_at 4939 OAS2 NM_0025 97.30 226.30 70.68 0.31 97.30 201.61 83.85 0.42 210773_s_at 2358 FPRL1 U81501 17.52 50.31 15.72 0.31 17.52 26.55 16.36 0.62 216866_s_at 7373 COL14 M64108 2.40 12.32 3.85 0.31 2.40 2.51 1.94 Al 209227_at AU15825 3.90 11.72 3.66 0.31 3.90 16.99 5.26 0.31 220904_at 80069 C6orf2O NM_0250 5.48 47.06 14.72 0.31 5.48 3.27 13.10 211249_at 8111 GPR68 U35398 61.33 99.46 31.15 0.31 61.33 33.60 5.73 205390_s_at 286 ANK1 M28880 3.52 10.86 3.41 0.31 3.52 2.87 4.57 204582_s_at 354 KLK3 NM_0016 4.35 33.76 10.60 0.31 4.35 22.15 5.64 0.25 217462 at 745 Cllorf9 AC00477 18.53 30.50 9.57 0.31 18.53 4.34 20.41 200606_at 1832 DSP NM_0044 3.38 18.42 5.79 0.31 3.38 15.98 8.00 0.50 207787_at 3884 KRT33 NM_0022 6.33 14.14 4.45 0.31 6.33 5.25 3.89 217936 at 394 ARHG AW04463 2.90 19.94 6.27 0.31 2.90 8.39 10.36 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 209573_s_at 753 C18orfl AF00942 25.53 39.61 12.51 0.32 25.53 11.16 16.79 206762_at 3741 KCNA5 NM_0022 5.05 22.65 7.16 0.32 5.05 2.47 1.79 205580_s_at 3269 HRH1 D28481 32.54 63.41 20.05 0.32 32.54 397.39 358.02 206614_at 8200 GDFS NM_0005 16.19 49.52 15.67 0.32 16.19 11.98 23.70 205660_at 8638 OASL NM_0037 88.99 341.25 108.14 0.32 88.99 365.73 178.92 0.49 204631_at 4620 MYH2 NM_0175 10.24 18.93 6.00 0.32 10.24 6.33 5.12 219430_at 56834 GPR13 NM_0201 34.07 59.77 18.96 0.32 34.07 5.67 40.13 216414_at AL13609 2.09 10.96 3.48 0.32 2.09 3.57 6.32 204681_s_at 9771 RAPGE NM_0122 4.61 15.65 4.97 0.32 4.61 1.66 3.45 211736_at 6668 SP2 BO00591 7.59 18.90 6.00 0.32 7.59 19.43 17.64 219955_at 54596 L1TD1 NM_0190 21.94 35.06 11.16 0.32 21.94 5.10 11.34 210940_s_at 2911 GRM1 U31216 4.20 30.54 9.72 0.32 4.20 14.81 9.69 0.65 207588_at 8827 MYT2 NM_0038 2.86 13.14 4.20 0.32 2.86 6.94 15.55 209038_s_at 10938 EHD1 AL57903 68.55 207.66 66.35 0.32 68.55 304.89 354.40 221385_s_at 2865 /// FFAR3 NM_0053 6.86 17.35 5.55 0.32 6.86 1.79 21.84 221359_at 2668 GDNF NM_0005 7.77 20.60 6.60 0.32 7.77 2.79 8.03 205798 at 3575 IL7R NM 0021 25.72 372.24 119.37 0.32 25.72 10147.44 4107.25 0.40 213972_at 2297 FOXD1 A1080288 11.48 62.74 20.13 0.32 11.48 10.73 16.16 208350_at 1446 CSN1S NM_0018 9.06 18.08 5.81 0.32 9.06 9.91 9.10 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 203404 at 9823 ARMC NM0147 13.42 27.70 8.91 0.32 13.42 10.45 2.40 220704_at 10320 IKZF1 NM 0185 45.18 143.43 46.24 0.32 45.18 177.07 159.62 203180_at 220 ALDH1 NM_0006 4.84 30.78 9.93 0.32 4.84 39.05 16.86 0.43 215042_at 654 BMP6 A1123471 3.86 30.84 9.97 0.32 3.86 5.90 8.18 210056_at 27289 RND1 U69563 16.25 41.60 13.45 0.32 16.25 65.86 56.09 221384_at 7350 UCP1 NM 0218 6.45 10.66 3.45 0.32 6.45 3.71 7.95 215721_at 3500 IGHG1 X58397 7.93 13.41 4.35 0.32 7.93 2.45 2.82 221162_at 10086 HHLA1 NM_0057 21.23 43.59 14.15 0.32 21.23 34.56 81.32 217502_at 3433 IFIT2 BE88874 10.20 191.10 62.04 0.32 10.20 90.52 91.62 205921_s_at 6533 SLC6A NM_0030 8.89 39.98 12.99 0.32 8.89 32.40 80.27 205308_at 51101 C8orf70 NM_0160 7.04 21.89 7.13 0.33 7.04 11.29 12.61 215730_at 51442 VGLL1 BE54232 15.71 30.24 9.86 0.33 15.71 25.82 16.11 0.62 206194_at 3221 HOXC4 AW29959 26.51 73.12 23.88 0.33 26.51 19.40 34.08 220727_at 54207 KCNK1 NM 0211 16.31 29.32 9.58 0.33 16.31 13.18 42.57 215449_at 222642 BZRPL A1052224 9.50 21.01 6.87 0.33 9.50 3.49 9.41 211891_s_at 50649 ARHG AB04219 13.55 33.86 11.07 0.33 13.55 3.82 9.10 212741 at 4128 MAOA AA92335 7.77 38.91 12.74 0.33 7.77 37.80 12.63 0.33 219313_at 54762 GRAM NM_0175 17.55 29.80 9.76 0.33 17.55 3.81 3.25 207571xat 9473 Clorf38 NM0048 247.84 585.69 191.78 0.33 247.84 479.11 237.70 0.50 222080_s_at AW18813 5.23 12.59 4.13 0.33 5.23 22.10 11.80 0.53 211869 at AF04965 4.51 11.08 3.63 0.33 4.51 4.25 6.89 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 219908_at 27123 DKK2 NM_0144 297.50 552.30 181.34 0.33 297.50 118.37 164.22 206171_at 140 ADOR NM_0006 18.81 31.77 10.44 0.33 18.81 17.38 11.07 202409_at 3481 /// IGF2 /// X07868 9.43 36.56 12.02 0.33 9.43 100.24 40.12 0.40 INS-216238_s_at 2244 FGB BG54528 3.14 17.17 5.65 0.33 3.14 7.71 5.91 208543_at 26538 OR10H NM_0139 2.93 12.83 4.23 0.33 2.93 2.72 1.59 207351_s_at 9047 SH2D2 NM_0039 91.41 152.14 50.15 0.33 91.41 255.43 76.03 0.30 205158_at 6038 RNASE NM_0029 8.41 16.86 5.56 0.33 8.41 2.15 6.69 209524_at 50810 HDGF AK00128 12.15 27.90 9.21 0.33 12.15 19.95 4.50 0.23 204747_at 3437 IFIT3 NM_0015 85.86 453.16 149.61 0.33 85.86 428.18 165.86 0.39 207471_at AF11808 12.05 18.79 6.21 0.33 12.05 12.80 14.03 214616_at 5030 P2RY4 NM_0035 14.73 68.02 22.47 0.33 14.73 40.29 9.78 0.24 214927_at 9358 ITGBL AL35905 5.75 30.10 9.95 0.33 5.75 3.92 5.67 215654_at 587 BCAT2 AK02390 36.62 63.94 21.18 0.33 36.62 32.84 47.95 219457_s_at 79890 RIN3 NM0248 145.15 326.81 108.28 0.33 145.15 154.47 69.03 205067_at 3553 IL1B NM_0005 51.79 821.35 272.30 0.33 51.79 14950.88 13257.5 AFFX-PheX- AFFX- 7.27 16.84 5.59 0.33 7.27 7.55 11.48 3 -at PheX-3 214717_at 150967 DKFZp AL13753 70.49 152.92 50.76 0.33 70.49 124.17 61.90 0.50 206867_at 2646 GCKR NM_0014 15.39 35.59 11.82 0.33 15.39 26.71 94.01 213917 at 7849 PAX8 BE46582 15.95 38.38 12.75 0.33 15.95 33.65 19.89 0.59 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 215488_at 2495 FTH1 AF05209 8.88 25.41 8.45 0.33 8.88 8.82 8.35 204939_s_at 5350 PLN NM_0026 2.41 12.30 4.09 0.33 2.41 1.45 2.33 207422 at 8748 ADAM NM 0038 5.74 21.40 7.13 0.33 5.74 3.32 10.99 211199_s_at 23308 ICOSL AF19902 4.73 115.17 38.40 0.33 4.73 176.99 171.19 215841_at 2979 GUCA1 AL09681 38.35 93.95 31.35 0.33 38.35 54.23 58.61 214477 at 4298 MLLT1 NM 0059 14.37 32.52 10.87 0.33 14.37 7.65 18.08 209504_s_at 58473 PLEKH AF08158 6.12 19.15 6.41 0.33 6.12 28.60 23.75 222213xat AU14780 14.35 38.34 12.83 0.33 14.35 29.79 11.54 0.39 214834 at 338427 SNRPN AU11887 19.02 72.84 24.40 0.33 19.02 4.45 18.83 PARS
SNOR

219073_s_at 114884 OSBPL NM_0177 22.63 35.48 11.95 0.34 22.63 27.95 11.15 206932_at 9023 CH25H NM_0039 12.68 19.37 6.52 0.34 12.68 5.11 22.82 215869_at 19 ABCA1 AK02225 12.25 31.02 10.46 0.34 12.25 15.61 12.90 205766_at 8557 TCAP NM_0036 11.35 28.86 9.74 0.34 11.35 62.73 15.68 0.25 205749_at 1543 CYP1A NM_0004 4.04 19.82 6.70 0.34 4.04 10.63 8.36 220462_at 80034 TAIP-2 NM_0249 6.18 15.19 5.15 0.34 6.18 3.19 6.38 203649_s_at 5320 PLA2G NM_0003 16.27 24.82 8.41 0.34 16.27 11.45 7.08 210785_s_at 9473 Clorf38 AB03548 337.82 690.32 234.69 0.34 337.82 707.56 298.39 0.42 220106_at 29881 NPC1L NM_0133 5.02 30.44 10.35 0.34 5.02 3.14 5.94 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 206149_at 63928 LOC63 NM_0220 2.22 16.22 5.52 0.34 2.22 6.62 4.92 206367_at 5972 REN NM_0005 7.44 11.60 3.95 0.34 7.44 4.31 4.56 220045 at 63974 NEUR NM0227 8.47 23.30 7.94 0.34 8.47 3.46 14.02 213667_at 10847 SRCAP AB00230 57.39 86.42 29.58 0.34 57.39 63.00 70.70 201006_at 7001 PRDX2 NM_0058 45.18 94.32 32.29 0.34 45.18 60.88 55.25 214591_at 56062 KLHL4 BF21567 4.00 20.10 6.88 0.34 4.00 7.89 16.22 215255_at 22997 IGSF9B AB02895 22.77 49.75 17.05 0.34 22.77 21.32 23.94 216089_at 645927 LOC64 BE87739 3.51 10.76 3.69 0.34 3.51 12.02 2.80 0.23 209723_at 5272 SERPI BC00253 34.25 57.27 19.65 0.34 34.25 762.07 215.01 0.28 203631_s_at 51704 GPRCS NM_0162 5.60 12.60 4.33 0.34 5.60 20.73 13.58 0.66 205234_at 9122 SLC16 NM_0046 8.29 29.56 10.17 0.34 8.29 41.22 38.14 216556_x_at AL13592 23.21 66.49 22.88 0.34 23.21 7.10 31.24 222187_x_at 10146 G3BP1 X78262 131.35 305.94 105.32 0.34 131.35 82.30 116.69 201820_at 3852 KRTS NM_0004 5.99 16.26 5.60 0.34 5.99 3.60 9.13 219998_at 29094 HSPC1 NM_0141 13.89 33.82 11.65 0.34 13.89 14.65 24.13 206560_s_at 8190 MIA NM_0065 16.79 44.64 15.38 0.34 16.79 8.50 40.53 206338_at 1995 ELAVL NM_0014 5.62 13.95 4.81 0.34 5.62 5.65 16.08 211142_x_at 3111 HLA- M38056 10.13 30.64 10.57 0.34 10.13 23.39 32.02 DOA

220621_at 2301 FOXES NM_0121 5.83 10.21 3.52 0.35 5.83 11.80 4.91 0.42 212515s at 1654 DDX3 BG49260 975.29 1688.85 582.96 0.35 975.29 948.43 1608.43 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 206119_at 635 BHMT NM_0017 12.35 40.03 13.84 0.35 12.35 6.24 7.79 219840_s_at 27004 TCL6 NM_0124 2.19 26.04 9.02 0.35 2.19 16.14 20.37 220066_at 64127 NOD2 NM_0221 100.06 518.34 179.49 0.35 100.06 160.53 72.19 0.45 216042_at 8718 TNFRS A1275938 53.72 83.57 28.94 0.35 53.72 33.41 23.47 44673_at 6614 SIGLE N53555 110.33 240.92 83.44 0.35 110.33 133.53 58.42 220409_at 157922 CAMS NM0186 13.42 44.47 15.41 0.35 13.42 33.59 33.18 206422_at 2641 GCG NM_0020 3.30 12.49 4.33 0.35 3.30 1.14 2.57 210090_at 23237 ARC AF19342 5.62 11.23 3.90 0.35 5.62 8.31 10.06 205503_at 5784 PTPN1 NM_0054 81.75 286.35 99.48 0.35 81.75 90.04 150.13 208937_s_at 3397 IDl D13889 38.28 58.63 20.38 0.35 38.28 38.87 47.81 207109_at 25833 POU2F NM_0143 4.94 25.39 8.83 0.35 4.94 4.12 1.62 213516_at 11214 AKAP1 AF12600 3.68 19.06 6.63 0.35 3.68 2.13 1.22 210770_s_at 773 CACN AF00488 90.72 165.84 57.75 0.35 90.72 65.91 43.85 AlA 4 221179_at NM_0250 5.06 21.79 7.60 0.35 5.06 8.60 3.46 211902_x_at 6955 TRA@ L34703 15.09 65.93 23.00 0.35 15.09 31.95 8.72 0.27 220779_at 51702 PADI3 NM_0162 6.69 21.45 7.48 0.35 6.69 8.76 6.24 216575_at AL03560 11.84 18.69 6.52 0.35 11.84 6.15 11.71 211369_at AF11668 8.41 15.47 5.40 0.35 8.41 5.22 25.02 217394_at 6955 TRA@ AE00065 9.58 22.31 7.79 0.35 9.58 11.89 10.21 207517_at 3918 LAMC NM 0188 7.34 13.44 4.70 0.35 7.34 4.53 2.97 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (10ng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa TMAA TMAA Control LPS TMAA TMAA
ink Symbol Derived (DMSO) (10ng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 216066_at 19 ABCA1 AK02432 17.06 60.72 21.23 0.35 17.06 51.27 100.81 219659_at 51761 ATP8A NM_0165 8.08 16.98 5.94 0.35 8.08 8.76 5.69 217158_at 728683 LOC72 X97875 4.27 13.91 4.87 0.35 4.27 10.65 2.77 0.26 204751xat 1824 DSC2 NM 0049 116.12 183.32 64.28 0.35 116.12 47.95 83.23 214963_at 23279 NUP16 AK02623 8.14 31.91 11.19 0.35 8.14 21.85 4.23 0.19 216219_at 363 AQP6 AL13771 20.19 58.03 20.36 0.35 20.19 53.01 32.39 0.61 207854_at 2996 GYPE NM_0021 3.22 12.33 4.33 0.35 3.22 3.89 2.19 214064_at 7018 TF A1073407 10.02 33.26 11.70 0.35 10.02 9.73 10.28 215125_s_at 54575 // UGT1A AV69132 8.08 20.36 7.16 0.35 8.08 6.56 13.78 219385_at 56833 SLAMF NM 0201 43.50 445.91 157.28 0.35 43.50 443.81 133.77 0.30 210229sat 1437 CSF2 M11734 5.89 13.16 4.64 0.35 5.89 7.30 51.72 204623_at 7033 TFF3 NM 0032 14.34 52.14 18.42 0.35 14.34 46.35 50.03 209914_s_at 9378 NRXN1 AW14940 10.64 25.39 9.00 0.35 10.64 4.60 30.18 218820_at 56967 C14orfl NM_0202 18.31 44.99 15.94 0.35 18.31 27.67 36.85 215530_at 2175 FANC BG48406 47.32 71.26 25.26 0.35 47.32 38.10 32.15 218600 at 80774 LIMD2 NM 0305 121.41 404.40 143.48 0.35 121.41 130.94 95.66 208083_s_at 3694 ITGB6 NM_0008 5.63 10.16 3.61 0.35 5.63 0.88 1.25 214650_x_at 4340 MOG AL05032 19.10 41.04 14.58 0.36 19.10 19.66 25.20 204642_at 1901 EDG1 NM_0014 7.29 24.67 8.79 0.36 7.29 7.02 7.62 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 213831_at 3117 HLA- X00452 2.11 10.87 3.87 0.36 2.11 2.63 6.44 214598_at 9073 CLDN8 AL04997 2.81 12.82 4.57 0.36 2.81 9.76 8.89 213252_at 9644 SH3PX A1739005 55.00 88.12 31.43 0.36 55.00 37.93 34.67 216017_s_at 4665 NAB2 AJ011081 150.35 501.93 179.05 0.36 150.35 410.79 1072.21 203541_s_at 687 KLF9 NM_0012 8.85 14.30 5.11 0.36 8.85 18.30 17.67 220749_at 79741 CIOorf6 NM_0246 19.62 33.19 11.86 0.36 19.62 11.38 20.86 AFFX- 6772 STAT1 AFFX- 333.13 792.85 283.54 0.36 333.13 356.02 297.74 IM97935_MB F3A/M97 _at 935_MB

200795_at 8404 SPARC NM_0046 8.32 18.73 6.70 0.36 8.32 8.98 4.29 212448_at 23327 NEDD4 AB00789 54.98 93.15 33.38 0.36 54.98 107.56 21.85 0.20 216892_at 3500 IGHG1 S65761 22.83 34.98 12.55 0.36 22.83 16.71 22.61 220194_at 79730 NSUN7 NM0246 4.84 12.38 4.44 0.36 4.84 3.35 4.21 213873_at D29810 26.79 41.92 15.04 0.36 26.79 20.44 24.28 206650_at 55721 IQCC NM_0181 22.11 48.73 17.51 0.36 22.11 41.53 20.04 0.48 214325_at 2813 GP2 BF04675 3.65 10.68 3.84 0.36 3.65 7.18 3.26 213498_at 90993 CREB3 BG32840 15.99 40.69 14.65 0.36 15.99 38.50 21.47 0.56 219010_at 55765 ClorflO NM_0182 397.55 1156.23 416.29 0.36 397.55 745.45 343.14 0.46 217629_at 2793 GNGT2 AA36567 19.33 31.12 11.21 0.36 19.33 26.85 15.35 210887_s_at 2121 EVC AF21618 10.29 23.25 8.38 0.36 10.29 17.78 32.87 210146_x_at 10288 // LILRB AF00423 32.40 56.81 20.47 0.36 32.40 125.79 14.82 0.12 LILRA

EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 204707_s_at 5596 MAPK BF11522 6.65 19.98 7.21 0.36 6.65 14.25 10.83 206730_at 2892 /// GRIA3 NM_0073 11.00 18.63 6.74 0.36 11.00 12.47 3.01 214856_at 6711 SPTBN BF43442 4.05 20.23 7.32 0.36 4.05 8.85 8.76 1255_g at 2978 GUCA1 L36861 5.92 10.68 3.87 0.36 5.92 12.38 6.69 0.54 A

210106_at 5959 RDH5 U43559 29.55 65.32 23.68 0.36 29.55 25.65 13.68 204288_s_at 8470 SORBS NM_0210 11.55 45.28 16.43 0.36 11.55 10.67 19.57 211667_x_at L34698 6.36 32.98 11.97 0.36 6.36 6.08 3.46 219042_at 11178 LZTS1 NM_0210 7.89 17.88 6.49 0.36 7.89 15.80 3.25 0.21 210797_s_at 8638 OASL AF06361 72.69 379.07 137.71 0.36 72.69 326.62 199.27 0.61 221303_at 29930 PCDHB NM_0133 9.73 17.04 6.21 0.36 9.73 26.11 22.12 214775_at 23138 N4BP3 AW13944 19.41 45.72 16.67 0.36 19.41 42.11 55.89 214821_at 291 SLC25 AF05211 17.95 37.73 13.76 0.36 17.95 22.55 22.74 216136_at AF11368 1.07 17.34 6.33 0.36 1.07 8.30 4.99 214633_at 6658 SOX3 A1824954 6.56 18.61 6.80 0.37 6.56 3.37 3.67 205116_at 3908 LAMA NM_0004 25.36 41.87 15.31 0.37 25.36 34.45 50.01 216729 at AK02538 14.14 22.32 8.16 0.37 14.14 20.26 7.24 221462_x_at 55554 KLK15 NM_0175 10.37 20.99 7.68 0.37 10.37 6.76 4.62 213961_s_at A1077556 21.60 33.32 12.22 0.37 21.60 8.63 10.54 215266 at 55567 DNAH AL09673 13.14 23.47 8.61 0.37 13.14 9.11 14.97 217326 x at 5644 PRSS1 AF00978 17.26 31.28 11.49 0.37 17.26 8.14 36.57 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 213071_at 1805 DPT AL04979 3.99 10.14 3.72 0.37 3.99 9.40 8.16 216390_at 3931 LCAT X06537 14.96 37.53 13.80 0.37 14.96 11.49 9.37 217217_at 10095 // ARPC1 X95660 6.17 15.48 5.69 0.37 6.17 11.37 2.53 0.22 B ///

219249_s_at 60681 FKBP1 NM_0219 3.14 10.62 3.92 0.37 3.14 5.88 5.38 206356_s_at 2774 GNAL NM_0020 2.16 26.24 9.69 0.37 2.16 15.47 13.67 215995_x_at 348094 ANKD AU14759 24.03 76.27 28.16 0.37 24.03 26.84 38.03 202728_s_at 4052 LTBP1 A1986120 8.78 18.39 6.79 0.37 8.78 13.09 6.50 204994_at 4600 MX2 NM 0024 401.48 1048.88 387.53 0.37 401.48 1233.73 323.72 0.26 211405xat 3451 IFNA17 M38289 46.09 101.45 37.49 0.37 46.09 27.81 12.90 207777_s_at 11262 SP140 NM 0072 12.91 33.57 12.41 0.37 12.91 3.29 7.68 220644_at NM0141 5.76 11.76 4.35 0.37 5.76 3.36 11.88 205294_at 10458 BAIAP AB01712 118.85 178.85 66.12 0.37 118.85 331.06 321.61 206894_at 337 APOA4 NM_0004 31.00 60.10 22.24 0.37 31.00 23.29 17.31 220588_at 55653 BCAS4 NM_0178 13.75 29.11 10.79 0.37 13.75 34.75 29.20 211719_x_at 2335 FN1 BC00585 3.41 30.07 11.15 0.37 3.41 71.30 59.05 208441_at 3480 IGF1R NM_0158 16.45 35.78 13.30 0.37 16.45 4.96 21.03 215026xat 6337 SCNN1 U81961 10.47 28.85 10.75 0.37 10.47 9.92 11.44 A

220135_s_at 11136 SLC7A NM_0142 19.32 36.20 13.49 0.37 19.32 35.00 11.86 0.34 222285_at 3495 IGHD AW13460 7.59 12.70 4.74 0.37 7.59 3.61 5.26 219691_at 54809 SAMD NM_0176 181.38 431.12 160.89 0.37 181.38 224.11 63.18 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 220630_s_at 27159 CHIA NM_0217 3.94 26.37 9.85 0.37 3.94 16.09 6.27 0.39 214603_at 266740 MAGE U82671 2.18 22.06 8.24 0.37 2.18 12.12 16.08 MAGE

213294 at AV75552 685.49 1711.91 639.85 0.37 685.49 2174.68 567.17 0.26 216127_at 64714 PDIA2 Z84717 2.37 11.67 4.36 0.37 2.37 4.45 6.00 221911_at 2115 ETV1 BE88159 16.14 38.28 14.32 0.37 16.14 8.57 1.62 206776_x_at 56 ACRV1 NM_0016 30.60 47.62 17.84 0.37 30.60 22.29 25.17 209182_s_at 11067 ClOorfl A1302100 40.04 71.88 26.93 0.37 40.04 60.12 64.91 206863_x_at U76376 2.87 10.35 3.88 0.37 2.87 4.60 1.98 202669_s_at 1948 EFNB2 U16797 11.10 23.81 8.93 0.38 11.10 31.06 59.31 217668_at 388886 C22orf3 BF51116 5.79 14.46 5.43 0.38 5.79 15.40 11.49 0.75 214294_at 57235 KIAAO A1122905 13.83 35.13 13.20 0.38 13.83 13.10 18.86 205559_s_at 5125 PCSKS NM_0062 6.41 27.47 10.32 0.38 6.41 62.04 151.92 219519_s_at 6614 SIGLE NM_0230 78.10 195.87 73.63 0.38 78.10 99.53 57.39 Cl 68 221631_at 8911 CACN AB03294 11.87 34.68 13.05 0.38 11.87 7.60 3.38 All 6 217207_s_at 10917 BTNL3 AK02526 66.36 100.17 37.73 0.38 66.36 57.86 64.04 216634_at 23007 PLCH1 AK02261 3.85 12.91 4.88 0.38 3.85 3.29 4.48 217444_at AL08008 7.09 26.70 10.10 0.38 7.09 8.08 20.65 204401 at 3783 KCNN4 NM 0022 417.08 778.30 294.43 0.38 417.08 717.37 520.42 0.73 207658_s_at 2290 /// FOXG1 NM_0044 16.27 56.80 21.49 0.38 16.27 13.11 37.03 A

217684 at 7298 TYMS BG28167 22.41 46.19 17.50 0.38 22.41 9.52 11.89 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 217374_x_at 6978 TRGVS AC00603 65.25 106.69 40.46 0.38 65.25 11.64 33.41 221386_at 4995 OR3A2 NM_0025 11.60 25.78 9.78 0.38 11.60 16.00 2.77 214054_at 9046 DOK2 A1828929 1119.54 1794.24 681.22 0.38 1119.54 1676.34 597.50 221174_at NM_0250 5.86 10.14 3.85 0.38 5.86 3.58 7.40 206196_s_at 10900 RPIP8 NM_0066 15.83 37.04 14.07 0.38 15.83 50.05 7.10 0.14 219412_at 23682 RAB38 NM_0223 51.61 250.31 95.08 0.38 51.61 367.63 94.16 0.26 217026_at 1080 CFTR M96936 10.26 16.74 6.36 0.38 10.26 16.06 3.71 0.23 217328_at 5644 PRSS1 AF00978 6.76 10.47 3.98 0.38 6.76 5.11 26.32 207470_at 54744 DKFZp NM_0175 7.75 33.34 12.68 0.38 7.75 10.24 13.98 221346_at 26476 OR10J1 NM_0123 11.04 82.22 31.33 0.38 11.04 39.70 15.43 0.39 209447_at 23345 SYNE1 AF04329 57.82 88.35 33.69 0.38 57.82 12.86 6.00 39402_at 3553 IL1B M15330 53.05 659.61 251.68 0.38 53.05 10198.17 10747.9 221271_at 59067 IL21 NM_0218 4.88 25.84 9.86 0.38 4.88 8.13 6.52 33304_at 3669 ISG20 U88964 56.23 136.14 51.99 0.38 56.23 280.62 206.24 0.73 209569_x_at 27065 D4S234 BC00174 3.37 14.40 5.50 0.38 3.37 8.65 16.76 202827_s_at 4323 MMP14 NM_0049 295.83 742.68 283.92 0.38 295.83 138.62 266.43 207505_at 5593 PRKG2 NM_0062 15.99 29.45 11.26 0.38 15.99 14.12 11.02 214542_x_at 8329 HIST1 NM_0035 42.02 74.04 28.34 0.38 42.02 12.67 26.61 220267_at 192666 KRT24 NM_0190 9.22 17.45 6.68 0.38 9.22 10.09 17.24 222059_at 63925 ZNF33 BE67647 5.30 31.65 12.13 0.38 5.30 45.87 6.36 0.14 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 220400_at 157680 VPS13 NM_0178 55.25 135.30 51.84 0.38 55.25 29.10 55.10 216546_s_at 1116 CHI3L1 AJ251847 56.96 88.89 34.14 0.38 56.96 232.14 88.08 0.38 215018_at 85459 KIAA1 AB05151 43.74 129.92 49.91 0.38 43.74 83.09 54.04 0.65 204400_at 10278 EFS NM_0058 11.59 17.58 6.77 0.38 11.59 10.91 5.57 206320_s_at 4093 SMAD NM_0059 4.12 17.46 6.74 0.39 4.12 23.63 13.28 0.56 216131_at 23150 FRMD4 AK00024 5.35 10.39 4.01 0.39 5.35 26.15 19.49 0.75 215657_at 1811 SLC26 AK02504 3.27 25.17 9.73 0.39 3.27 6.79 2.90 222257_s_at 59272 ACE2 AK02646 4.74 25.89 10.00 0.39 4.74 3.39 6.33 209652_s_at 5228 PGF BC00142 7.67 17.05 6.59 0.39 7.67 26.24 2.99 0.11 207757_at 80108 ZFP2 NM_0306 67.18 145.15 56.12 0.39 67.18 174.02 83.37 0.48 208600_s_at 2863 GPR39 NM_0015 5.14 17.35 6.72 0.39 5.14 7.59 9.14 206360_s_at 9021 SOCS3 NM_0039 24.04 85.62 33.20 0.39 24.04 77.00 135.95 215159_s_at 65220 NADK A1239732 104.97 185.45 72.01 0.39 104.97 60.43 71.45 209291_at 3400 ID4 AW15709 4.93 19.22 7.46 0.39 4.93 9.72 2.43 214032 at 7535 ZAP70 A1817942 3.45 14.45 5.61 0.39 3.45 20.24 20.35 210883_x_at 1949 EFNB3 U57001 32.26 66.56 25.87 0.39 32.26 54.90 46.17 220498_at 10880 ACTL7 NM_0066 6.35 12.88 5.01 0.39 6.35 9.72 10.31 215617 at AU14571 205.43 504.63 196.27 0.39 205.43 419.40 171.84 0.41 205685_at 942 CD86 BG23628 30.48 81.94 31.89 0.39 30.48 115.04 45.44 0.39 211374xat AF11671 51.83 89.47 34.82 0.39 51.83 49.98 27.24 204197_s_at 864 RUNX3 NM_0043 703.88 1070.81 416.78 0.39 703.88 1210.69 546.84 0.45 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 214899_at 163131 ZNF78 AC00784 8.82 17.79 6.93 0.39 8.82 11.84 16.82 206032_at 1825 DSC3 A1797281 76.10 230.70 89.88 0.39 76.10 156.10 163.08 206985_at 3293 HSD17 NM_0001 8.11 44.81 17.48 0.39 8.11 6.01 7.71 214669_x_at 3107 HLA-C BG48513 12.06 123.66 48.25 0.39 12.06 30.48 45.50 214084_x_at 29 ABR AW07238 209.66 634.85 247.92 0.39 209.66 192.68 69.85 214609_at 401 PHOX2 A1469991 13.14 50.09 19.57 0.39 13.14 31.71 40.05 A

209371_s_at 6452 SH3BP A1393190 112.60 236.00 92.21 0.39 112.60 125.14 101.81 211325xat 171220 LOC17 U72518 170.02 257.02 100.44 0.39 170.02 153.21 185.96 216118_at AU14802 20.52 35.35 13.82 0.39 20.52 52.25 15.01 0.29 202145_at 4061 LY6E NM_0023 309.94 600.22 235.08 0.39 309.94 284.59 162.84 211577_s_at 3479 IGF1 M37484 16.77 62.69 24.61 0.39 16.77 18.90 30.79 213317_at 53405 CLICS AL04931 6.34 33.34 13.10 0.39 6.34 119.62 151.72 207709_at 5563 PRKA NM_0062 10.29 34.74 13.66 0.39 10.29 32.52 8.62 0.27 222363_at AW97901 12.38 124.76 49.10 0.39 12.38 36.51 35.86 213559_s_at 168544 ZNF46 BF22340 4.10 13.65 5.37 0.39 4.10 3.74 2.50 210441_at 8556 CDC14 AF06410 42.69 67.52 26.60 0.39 42.69 48.45 40.23 204549_at 9641 IKBKE NM_0140 211.41 610.47 240.71 0.39 211.41 492.09 169.75 0.34 217101_at 22996 Clorf34 AB00792 6.03 21.09 8.32 0.39 6.03 4.42 3.17 206639_x_at 3346 HTN1 NM_0021 12.95 23.78 9.39 0.39 12.95 4.78 12.14 220101 x at NM_0186 24.49 49.27 19.46 0.40 24.49 38.90 20.71 0.53 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 218312_s_at 65982 ZNF44 NM_0239 3.67 29.94 11.84 0.40 3.67 5.22 6.35 215068_s_at 80028 FBXL1 BC00422 103.91 161.23 63.87 0.40 103.91 93.60 55.45 204211_x_at 5610 EIF2A NM_0027 536.17 1173.56 465.02 0.40 536.17 846.82 467.26 0.55 216795_at AK02684 5.08 37.28 14.78 0.40 5.08 16.70 3.61 0.22 221990_at 7849 PAX8 A1948472 6.46 12.60 5.00 0.40 6.46 11.75 4.10 0.35 206903_at NM_0057 13.26 20.38 8.08 0.40 13.26 21.18 11.03 0.52 215717sat 2201 FBN2 X62009 37.77 64.85 25.72 0.40 37.77 44.55 24.92 210751_s_at 9104 RGN D31815 12.81 20.62 8.18 0.40 12.81 3.35 5.45 211215_x_at 1734 D1O2 AB04184 12.09 21.26 8.44 0.40 12.09 8.02 8.57 210583_at 84271 POLDI AB05576 13.11 29.55 11.73 0.40 13.11 6.56 19.95 218744_s_at 29763 PACSI NM_0162 7.19 16.23 6.45 0.40 7.19 5.03 12.05 217190_x_at 2099 ESR1 S67777 7.98 32.15 12.79 0.40 7.98 6.06 13.38 219883_at NM_0166 36.71 67.19 26.73 0.40 36.71 46.04 20.34 220861_at NM_0140 11.40 22.11 8.80 0.40 11.40 16.59 29.43 216743_at 112 ADCY6 AK02491 3.10 11.02 4.39 0.40 3.10 4.46 2.79 207072_at 8807 IL18RA NM_0038 45.16 229.00 91.30 0.40 45.16 445.08 92.54 0.21 207561_s_at 9311 ACCN3 NM_0203 23.92 53.84 21.47 0.40 23.92 38.31 25.16 0.66 207715_at 1419 CRYG NM_0052 2.99 13.40 5.35 0.40 2.99 3.79 5.19 215680_at 85368 KIAA1 AB05144 6.82 22.18 8.85 0.40 6.82 15.12 17.30 208134_x_at 5670 PSG2 NM_0312 3.32 22.18 8.85 0.40 3.32 3.18 31.50 209697_at 5533 PPP3C BC00486 10.69 20.97 8.38 0.40 10.69 2.62 5.81 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 210767_at 4771 NF2 BC00311 7.55 20.00 7.99 0.40 7.55 22.47 14.39 0.64 221127_s_at 10530 RIG NM_0063 2.03 15.06 6.02 0.40 2.03 5.55 1.17 207652_s_at 1240 CMKL NM_0040 5.77 13.59 5.43 0.40 5.77 5.34 6.39 219947 at 50856 CLEC4 NM 0161 1.37 29.36 11.75 0.40 1.37 17.45 13.29 211771_s_at 5452 POU2F BO00610 80.85 363.75 145.69 0.40 80.85 551.98 530.55 204248_at 2767 GNA11 NM_0020 61.62 126.80 50.88 0.40 61.62 96.45 27.12 0.28 215955xat 23092 ARHG Y10388 144.84 218.54 87.81 0.40 144.84 40.81 194.38 203217_s_at 8869 ST3GA NM_0038 200.17 321.04 129.03 0.40 200.17 297.64 97.14 205942_s_at 6296 ACSM3 NM_0056 4.28 36.98 14.86 0.40 4.28 5.39 3.77 214569 at 3442 IFNA5 NM 0021 7.73 19.89 8.00 0.40 7.73 2.75 17.81 216374_at AC00698 28.50 51.65 20.78 0.40 28.50 29.47 37.57 205803_s_at 7220 TRPC1 NM_0033 19.99 50.43 20.31 0.40 19.99 16.57 31.48 207639_at 8326 FZD9 NM_0035 39.73 68.93 27.76 0.40 39.73 39.09 42.81 211457_at 23766 GAGA AF18051 4.35 25.70 10.35 0.40 4.35 16.09 3.95 0.25 208712_at 595 CCND1 M73554 43.20 115.86 46.75 0.40 43.20 67.62 70.85 210304_at 5158 PDE6B BC00024 5.05 47.16 19.03 0.40 5.05 11.49 10.98 216736 at 53345 TM6SF AK02451 11.30 24.15 9.75 0.40 11.30 17.42 8.77 0.50 211314 at 8913 CACN AB01204 5.24 12.16 4.91 0.40 5.24 8.03 15.36 AFFX- 6772 STAT1 AFFX- 445.10 1072.24 433.37 0.40 445.10 557.35 376.96 IM97935_MA F3A/M97 _at 935_MA

217308 at 26184 OR1F2 AJ003145 2.89 15.87 6.42 0.40 2.89 3.11 22.98 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 212803_at 4665 NAB2 BF33732 254.48 796.94 322.72 0.40 254.48 944.78 1422.16 220681_at 55267 C22orf2 NM_0182 23.29 73.80 29.90 0.41 23.29 18.00 32.96 219958 at 55321 C20orf4 NM 0183 27.49 45.51 18.44 0.41 27.49 39.90 45.21 221226_s_at 55515 ACCN4 NM_0186 6.49 14.31 5.80 0.41 6.49 6.15 6.05 212706_at 10156 RASA4 A1738591 250.46 652.76 265.06 0.41 250.46 572.38 241.22 0.42 211300sat 7157 TP53 K03199 14.40 32.51 13.20 0.41 14.40 13.33 19.24 221323_at 80329 ULBP1 NM_0252 7.96 43.18 17.53 0.41 7.96 11.10 70.11 208851_s_at 7070 THY1 AL16195 31.49 66.80 27.13 0.41 31.49 10.19 20.89 204803_s_at 6236 RRAD NM_0041 12.44 107.26 43.64 0.41 12.44 266.20 688.02 219091_s_at 79812 MMRN NM_0247 30.82 49.04 19.96 0.41 30.82 29.01 22.77 210800_at 1678 TIMM8 BC00523 17.06 33.69 13.74 0.41 17.06 12.81 10.08 212921_at 56950 SMYD AF07059 39.59 83.90 34.23 0.41 39.59 52.73 45.12 218410sat 283871 LOC28 NM 0241 44.67 76.47 31.22 0.41 44.67 27.84 10.67 214398_s_at 9641 IKBKE AW34033 192.89 641.33 261.99 0.41 192.89 244.87 155.52 206957_at 189 AGXT NM_0162 1.69 22.37 9.14 0.41 1.69 11.70 3.88 0.33 216419_at 9696 CROC AK02691 18.87 49.78 20.34 0.41 18.87 37.46 8.61 0.23 203940_s_at 22846 VASH1 NM_0149 112.21 213.08 87.13 0.41 112.21 111.34 60.99 206133_at 54739 BIRC4 NM_0175 429.25 1584.83 648.08 0.41 429.25 830.56 290.18 0.35 213462_at 4862 NPAS2 AW00092 19.40 59.25 24.27 0.41 19.40 55.39 80.46 206212_at 1358 CPA2 NM_0018 39.95 74.70 30.60 0.41 39.95 41.82 19.46 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 205009_at 7031 TFF1 NM_0032 6.32 23.62 9.68 0.41 6.32 14.42 3.85 0.27 219256_s_at 54436 SH3TC NM_0189 193.32 431.34 176.95 0.41 193.32 285.80 129.56 AFFX-TrpnX- AFFX- 2.57 11.24 4.62 0.41 2.57 5.13 3.89 3-at TrpnX-3 206186_at 4356 MPP3 NM_0019 43.70 79.92 32.88 0.41 43.70 39.10 79.49 215477 at H49077 22.60 35.27 14.51 0.41 22.60 2.77 13.86 217601 at 23511 NUP18 AL52318 53.17 104.72 43.10 0.41 53.17 72.84 50.59 221924_at 83637 ZMIZ2 AW44496 232.18 805.22 331.45 0.41 232.18 821.46 529.04 0.64 206317_s_at 11194 ABCB8 NM_0071 25.97 98.14 40.41 0.41 25.97 15.87 43.98 210064_s_at 7348 UPK1B NM_0069 14.42 22.55 9.29 0.41 14.42 22.60 16.50 0.73 214046_at AA01772 17.22 25.97 10.72 0.41 17.22 14.30 17.89 209834_at 9469 CHST3 AB01791 24.75 50.34 20.79 0.41 24.75 74.27 30.91 0.42 205391_x_at 286 ANK1 M28880 2.50 10.33 4.26 0.41 2.50 12.86 4.43 0.34 203071_at 7869 SEMA3 NM_0046 6.04 10.60 4.38 0.41 6.04 7.89 5.95 221106_at 51310 SLC22 NM_0166 13.05 42.50 17.57 0.41 13.05 32.31 29.55 205293_x_at 10458 BAIAP AB01712 81.77 154.22 63.80 0.41 81.77 265.59 268.76 213450_s_at 23308 ICOSL A1659611 141.14 445.28 184.26 0.41 141.14 855.53 713.61 G

216670_at 26085 KLK13 AL05022 5.86 16.72 6.92 0.41 5.86 5.37 6.29 216919_at 9537 TP5311 U79302 28.48 56.21 23.28 0.41 28.48 47.67 41.85 205568_at 366 AQP9 NM_0209 3.15 12.81 5.30 0.41 3.15 57.07 96.71 215671 at 5142 PDE4B AU14479 3.90 62.94 26.07 0.41 3.90 80.18 50.21 0.63 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (10ng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (10ng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 218704_at 54894 RNF43 NM0177 7.69 15.77 6.53 0.41 7.69 13.71 12.34 207921xat 7849 PAX8 NM 0139 14.83 34.92 14.47 0.41 14.83 17.68 19.77 208436_s_at 3665 IRF7 NM_0040 352.89 1349.42 559.42 0.41 352.89 1434.35 576.39 0.40 204741_at 636 BICD1 NM_0017 59.33 142.85 59.24 0.41 59.33 115.28 91.33 206378_at 4250 SCGB2 NM_0024 2.44 16.24 6.73 0.41 2.44 6.33 6.51 209589_s_at 2048 EPHB2 AF02530 4.95 16.88 7.00 0.41 4.95 38.60 4.17 0.11 206504_at 1591 CYP24 NM_0007 3.82 20.09 8.34 0.41 3.82 14.40 6.96 0.48 Al 82 204501_at 4856 NOV NM_0025 16.91 43.40 18.02 0.42 16.91 15.13 20.71 217220_at AL05015 2.47 16.81 6.98 0.42 2.47 13.14 17.75 201236_s_at 7832 BTG2 BG33906 504.34 3730.56 1551.96 0.42 504.34 5160.39 5204.92 203088_at 10516 FBLNS NM_0063 5.51 37.36 15.55 0.42 5.51 21.14 13.55 0.64 205693_at 7140 TNNT3 NM_0067 16.96 38.24 15.92 0.42 16.96 13.02 16.63 216180sat 8871 SYNJ2 AK02675 20.07 55.74 23.22 0.42 20.07 43.87 138.70 222336_at 201895 C4orf34 AW97491 8.31 24.32 10.14 0.42 8.31 20.02 15.58 210634_at 27252 KLHL2 B000525 4.10 60.74 25.34 0.42 4.10 25.74 6.05 0.24 220719_at 80079 FLJ137 NM0250 23.37 53.64 22.38 0.42 23.37 24.74 33.70 217049_x_at 83259 PCDH1 AJ276803 29.07 49.70 20.75 0.42 29.07 57.68 36.85 0.64 lY

216184_s_at 22999 RIMS1 AF26331 2.28 10.50 4.38 0.42 2.28 2.00 7.78 217121 at 8658 TNKS AF08255 15.14 29.29 12.24 0.42 15.14 3.52 12.40 221357_at 1132 CHRM NM_0007 23.68 39.30 16.43 0.42 23.68 17.90 19.28 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 214768 x at 3107 HLA-C BG54062 38.74 87.89 36.75 0.42 38.74 47.79 15.63 203980_at 2167 FABP4 NM_0014 5.97 35.60 14.89 0.42 5.97 139.54 8.74 0.06 207689_at 347853 TBX10 NM_0059 16.00 30.47 12.75 0.42 16.00 19.73 5.02 204929_s_at 10791 VAMP NM_0066 56.53 88.95 37.24 0.42 56.53 33.09 35.23 220692_at 246721 POLR2 NM_0141 122.96 284.17 119.05 0.42 122.96 236.10 107.81 0.46 201601_x_at 8519 IFITMI NM_0036 763.85 1339.59 561.23 0.42 763.85 991.47 521.37 213949_s_at 83475 DOHH A1370867 5.39 15.21 6.38 0.42 5.39 28.56 10.13 0.35 221200_at NM_0221 11.57 35.50 14.90 0.42 11.57 133.61 82.10 0.61 206179_s_at 11076 TPPP NM_0070 13.85 30.12 12.66 0.42 13.85 27.82 41.06 207389_at 2811 GP1BA NM_0001 50.73 135.31 56.94 0.42 50.73 155.89 88.98 0.57 215583_at 9725 TMEM AU14818 76.40 127.56 53.70 0.42 76.40 56.85 20.29 214038_at 6355 CCL8 A1984980 4.39 202.95 85.48 0.42 4.39 1064.30 160.82 0.15 208397_x_at 3762 KCNJS U39195 6.90 15.97 6.73 0.42 6.90 6.32 6.81 205728 at AL02271 7.21 20.74 8.74 0.42 7.21 17.02 13.42 221578_at 83937 RASSF AF26033 237.66 705.35 298.06 0.42 237.66 605.86 441.42 0.73 214223 at AA42773 12.07 20.87 8.83 0.42 12.07 5.10 26.09 215928 at 84448 ABLIM AK02219 4.87 12.70 5.38 0.42 4.87 15.15 21.61 210237_at 9048 ARTN AF12027 8.78 18.25 7.73 0.42 8.78 21.46 10.59 0.49 217302_at 135948 0R2F2 AC00485 18.04 53.83 22.82 0.42 18.04 32.41 26.16 42361_g at 54535 CCHC A1588986 69.42 126.04 53.47 0.42 69.42 79.47 63.80 221119 at 54848 FLJ201 NM 0177 12.86 31.29 13.28 0.42 12.86 23.69 8.38 0.35 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 210772_at 2358 FPRL1 M88107 43.23 75.72 32.13 0.42 43.23 92.72 6.49 0.07 207339_s_at 4050 LTB NM_0023 175.05 492.42 209.20 0.42 175.05 139.08 100.65 217523_at 960 CD44 AV70029 65.00 330.57 140.49 0.42 65.00 1111.13 1674.02 215485_s_at 3383 ICAM1 AA28470 52.06 355.68 151.18 0.43 52.06 315.11 268.32 200785_s_at 4035 LRP1 NM_0023 13.80 24.68 10.51 0.43 13.80 26.69 19.12 0.72 220293_at 79820 C14orfl NM0247 14.18 21.38 9.10 0.43 14.18 20.25 13.64 209491_s_at 272 /// AMPD AA91911 22.46 47.78 20.36 0.43 22.46 52.85 60.46 PPARA
TRMU
216800_at AK02706 13.56 22.16 9.45 0.43 13.56 10.90 7.51 213688_at 801 CALM N25325 75.21 123.85 52.85 0.43 75.21 84.07 129.22 216955_at 6872 TAF1 X07024 19.26 57.42 24.50 0.43 19.26 16.81 12.02 206729_at 943 TNFRS NM_0012 42.36 67.47 28.81 0.43 42.36 46.66 30.11 219867_at 140578 CHOD NM_0249 11.63 37.14 15.86 0.43 11.63 26.83 9.91 0.37 221029_s_at 81029 WNTS NM0307 5.45 40.16 17.18 0.43 5.45 39.30 44.46 211302_s_at 5142 PDE4B L20966 42.56 694.41 297.31 0.43 42.56 785.18 723.06 220280_s_at 51281 ANKM NM_0165 20.15 30.77 13.19 0.43 20.15 7.98 17.60 216019_x_at 23187 PHLDB AK02169 7.22 34.45 14.76 0.43 7.22 41.34 42.25 206864_s_at 8739 HRK NM_0038 16.85 42.67 18.31 0.43 16.85 7.68 17.84 216155_at 89796 NAV1 AK02454 13.53 25.34 10.88 0.43 13.53 14.37 2.87 211399 at 2263 FGFR2 AB03007 6.42 13.38 5.74 0.43 6.42 15.18 6.85 0.45 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 205912_at 5406 PNLIP NM_0009 5.34 11.56 4.96 0.43 5.34 12.41 9.04 0.73 212654_at 122769 TPM2 AL56678 37.37 59.97 25.79 0.43 37.37 27.02 44.82 222368 at AW97235 77.14 124.37 53.52 0.43 77.14 65.70 67.96 211031_s_at 7461 CYLN2 BC00625 106.20 314.64 135.40 0.43 106.20 1680.79 835.64 0.50 220683_at 50700 RDH8 NM_0157 17.71 28.18 12.13 0.43 17.71 4.07 24.89 219503_s_at 55287 TMEM A1087937 18.25 42.85 18.44 0.43 18.25 19.57 20.62 220207_at 541469 LOC54 NM0221 11.46 47.81 20.58 0.43 11.46 12.60 13.52 221773_at 2004 ELK3 AW57537 539.20 858.25 369.85 0.43 539.20 866.34 237.59 0.27 209969_s_at 6772 STAT1 BC00270 182.75 975.92 420.63 0.43 182.75 1024.44 251.62 0.25 204259_at 4316 MMP7 NM 0024 4.44 14.69 6.33 0.43 4.44 8.81 33.19 209641_s_at 8714 ABCC3 AF00967 6.47 11.48 4.95 0.43 6.47 66.70 82.57 220733_at 10861 SLC26 NM_0220 6.30 10.59 4.57 0.43 6.30 5.69 7.52 Al 42 221072_at 57000 C9orf31 NM_0202 7.00 11.67 5.04 0.43 7.00 5.84 3.59 204961_s_at 653361 NCF1 NM_0002 176.02 536.94 231.99 0.43 176.02 178.48 58.28 221134_at 51378 ANGPT NM_0159 18.36 46.80 20.26 0.43 18.36 32.58 46.40 210348_at 5414 4-Sep AF17637 4.64 32.31 14.00 0.43 4.64 2.40 12.91 221122_at 54979 HRASL NM_0178 6.52 13.21 5.72 0.43 6.52 35.01 9.47 0.27 213931_at 3398 /// ID2 A1819238 374.59 707.10 306.79 0.43 374.59 1599.99 626.43 0.39 220204 s at 353500 BMP8A NM 0247 12.62 19.16 8.32 0.43 12.62 7.06 10.70 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 214403_x_at 25803 SPDEF A1307915 33.45 93.08 40.42 0.43 33.45 61.99 29.06 0.47 211170_s_at 10846 PDE10 AF12748 4.94 11.39 4.95 0.43 4.94 3.23 7.27 215782_at 286526 LOC28 Z95624 38.92 64.80 28.17 0.43 38.92 31.54 12.63 204560_at 2289 FKBP5 NM_0041 345.23 708.34 308.31 0.44 345.23 501.04 544.14 220501_at 10881 ACTL7 NM_0066 11.38 17.22 7.50 0.44 11.38 16.65 7.05 219093_at 55022 FLJ207 NM_0179 24.06 45.92 19.99 0.44 24.06 312.11 118.09 0.38 205712_at 5789 PTPRD NM_0028 15.72 29.99 13.08 0.44 15.72 6.14 9.42 214025_at 55794 DDX28 A1922937 9.71 41.80 18.24 0.44 9.71 24.81 10.46 0.42 218978_s_at 51312 SLC25 NM_0185 61.04 107.49 46.92 0.44 61.04 40.60 25.61 220283_at 79802 KIAA1 NM_0247 6.84 24.09 10.54 0.44 6.84 38.16 35.00 218599_at 9985 REC8L NM_0051 175.87 455.17 199.13 0.44 175.87 315.80 188.42 0.60 211197_s_at 23308 ICOSL AL35569 82.89 197.58 86.46 0.44 82.89 583.18 517.54 205850_s_at 2562 GABR NM_0008 11.87 19.37 8.48 0.44 11.87 3.91 5.46 212657_s_at 3557 IL1RN AW08335 720.99 1159.37 508.51 0.44 720.99 2738.88 4547.59 221730_at 1290 COLSA AL57573 7.38 14.21 6.24 0.44 7.38 234.04 114.89 0.49 200644_at 65108 MARC NM_0230 265.69 552.74 243.42 0.44 265.69 1538.92 952.19 0.62 208012_x_at 3431 SP110 NM_0045 699.65 1152.86 508.05 0.44 699.65 990.50 276.84 211819_s_at 10580 SORBS AF13638 36.13 64.25 28.32 0.44 36.13 37.83 42.91 216809_at 1538 CYLC1 Z22780 23.47 37.70 16.63 0.44 23.47 34.92 41.50 216701_at 553168 Clorf68 AF00508 10.18 24.21 10.68 0.44 10.18 9.12 12.10 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 214667_s_at 9537 TP5311 AK02660 22.50 93.09 41.10 0.44 22.50 78.35 101.24 202206_at 10123 ARL4C AW45036 154.68 233.51 103.15 0.44 154.68 165.44 92.25 217505_at 151230 KLHL2 BG40379 11.10 29.89 13.22 0.44 11.10 15.93 2.20 222202_at 644213 LOC64 AK02435 1.30 13.55 5.99 0.44 1.30 12.69 1.22 0.10 209603_at 2625 GATA3 A1796169 3.90 11.52 5.10 0.44 3.90 10.57 5.50 0.52 220920_at 23120 ATP10 NM_0251 12.31 53.50 23.70 0.44 12.31 45.10 26.64 0.59 213033_s_at 4781 NFIB A1186739 3.22 12.02 5.34 0.44 3.22 2.92 2.42 210352_at 10902 BRD8 AL13682 3.52 39.59 17.61 0.44 3.52 8.22 13.35 217074_at 54498 SMOX AK02593 4.72 26.10 11.62 0.45 4.72 21.62 33.60 215779_s_at 8339 HIST1 BE27147 35.37 91.29 40.64 0.45 35.37 55.16 59.76 213413_at 11037 STON1 BG43417 7.75 13.60 6.06 0.45 7.75 18.09 9.58 0.53 205913_at 5346 PLIN NM_0026 4.07 12.27 5.47 0.45 4.07 2.73 3.69 211147_s_at 9127 P2RXL AF06538 6.45 14.73 6.57 0.45 6.45 7.05 15.91 215141_at 317648 C4orfl0 AA49330 14.54 43.10 19.25 0.45 14.54 9.24 9.62 205696_s_at 2674 GFRA1 U97144 12.08 22.04 9.85 0.45 12.08 3.91 10.50 204908_s_at 602 BCL3 NM 0051 164.74 2982.82 1333.44 0.45 164.74 2151.79 1227.55 0.57 216292_at 5797 PTPRM AK02445 25.55 65.71 29.42 0.45 25.55 43.71 21.62 0.49 208136_s_at 81854 MGC37 NM_0309 15.87 40.70 18.24 0.45 15.87 18.10 26.01 215487_x_at 388358 RP13- AL09672 8.75 21.94 9.83 0.45 8.75 5.45 8.55 / 401N8. 7 206672_at 359 AQP2 NM_0004 20.72 98.99 44.38 0.45 20.72 62.52 50.65 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 210603_at 84779 MGC10 BO00455 35.55 55.00 24.68 0.45 35.55 26.32 39.37 205312_at 6688 SPI1 NM_0031 892.79 2323.94 1043.34 0.45 892.79 1948.44 1530.45 210272_at 1556 CYP2B M29873 26.67 50.74 22.78 0.45 26.67 16.86 11.71 213845_at 2898 GRIK2 AL35553 85.54 145.33 65.33 0.45 85.54 104.12 89.43 205861_at 6689 SPIB NM_0031 187.26 582.49 261.87 0.45 187.26 113.49 33.03 212423_at 219654 CIOorf5 AK02478 132.23 259.80 116.92 0.45 132.23 207.76 215.60 207462_at 2742 GLRA2 NM_0020 13.25 21.78 9.81 0.45 13.25 15.28 37.06 205605_at 3235 HOXD NM_0142 10.80 18.86 8.50 0.45 10.80 2.85 3.80 221159_at NM 0164 12.92 75.39 34.01 0.45 12.92 11.37 9.72 213324_at 6714 SRC AK02428 11.16 238.31 107.56 0.45 11.16 489.69 657.07 206534_at 2903 GRIN2 NM_0008 14.61 22.18 10.02 0.45 14.61 15.04 7.84 220365_at 55821 ALLC NM_0184 19.60 46.86 21.16 0.45 19.60 45.24 17.49 0.39 220303_at 79849 PDZD3 NM_0247 11.35 28.37 12.82 0.45 11.35 12.57 14.38 213985_s_at 91304 C19orf6 H45660 18.95 42.38 19.16 0.45 18.95 20.74 23.64 207407xat 1579 CYP4A NM0007 10.17 16.57 7.49 0.45 10.17 4.98 23.32 207881_at NM 0158 14.31 23.19 10.50 0.45 14.31 19.25 3.75 214521_at 54626 HES2 NM_0190 2.19 12.42 5.63 0.45 2.19 13.35 3.61 0.27 202953_at 713 C1QB NM_0004 5.39 31.18 14.14 0.45 5.39 5.07 3.14 206893_at 6299 SALL1 NM_0029 3.19 15.53 7.04 0.45 3.19 10.77 3.13 0.29 221975s at 755 C2lorf2 A1539305 52.65 101.92 46.25 0.45 52.65 126.57 48.58 0.38 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 217465_at 10787 NCKA AK00129 18.60 41.42 18.80 0.45 18.60 15.60 6.48 219983_at 57110 HRASL NM_0203 5.68 13.48 6.12 0.45 5.68 6.77 7.42 217867_x_at 25825 BACE2 AF17853 13.85 24.09 10.94 0.45 13.85 10.30 8.86 210330_at 6444 SGCD U58331 2.30 11.65 5.30 0.45 2.30 25.17 1.08 0.04 215331_at 22989 MYH15 BF06294 13.07 38.31 17.41 0.45 13.07 24.30 6.75 0.28 214421_x_at 1559 CYP2C AV65242 16.69 42.36 19.25 0.45 16.69 24.55 17.90 221784_at 58525 WIZ A1828531 16.16 41.37 18.80 0.45 16.16 38.04 63.61 208017_s_at 4168 MCF2 NM_0053 3.22 15.88 7.22 0.45 3.22 12.11 7.74 0.64 207217_s_at 27035 NOX1 NM 0139 20.84 34.03 15.48 0.45 20.84 7.81 9.77 217272_s_at 5275 SERPI AJ001698 10.98 25.76 11.73 0.46 10.98 28.97 10.75 0.37 208344_x_at 3447 IFNA13 NM_0069 12.26 36.18 16.47 0.46 12.26 20.59 6.14 0.30 217253_at L37198 83.15 179.63 81.80 0.46 83.15 214.50 79.03 0.37 221465_at 8590 OR6A2 NM_0036 4.47 10.29 4.69 0.46 4.47 5.20 7.49 221415_s_at 81025 GJA10 NM_0307 16.11 64.23 29.28 0.46 16.11 37.27 36.01 218952_at 27344 PCSK1 NM_0132 21.06 65.45 29.86 0.46 21.06 13.22 36.47 217180_at 96610 LOC96 X79782 7.02 11.81 5.40 0.46 7.02 18.38 5.46 0.30 221184_at NM_0250 10.05 50.83 23.29 0.46 10.05 19.95 39.95 210839_s_at 5168 ENPP2 D45421 30.55 89.57 41.05 0.46 30.55 13.53 30.26 215142_at 25763 CXorf2 AA81527 4.69 19.24 8.82 0.46 4.69 13.11 5.56 0.42 219775_s_at 594855 CPLX3 NM_0246 11.29 19.61 8.99 0.46 11.29 10.98 6.92 206150_at 939 CD27 NM_0012 9.95 39.60 18.17 0.46 9.95 11.18 20.17 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 206876_at 6492 SIM1 AL12194 75.31 127.30 58.44 0.46 75.31 278.72 254.63 218293_x_at 10762 NUP50 AF26786 32.63 77.95 35.80 0.46 32.63 27.97 16.46 214349_at AV76437 191.98 336.49 154.64 0.46 191.98 120.06 171.10 204595_s_at 6781 STC1 A1300520 15.57 35.50 16.32 0.46 15.57 35.63 44.51 205119_s_at 2357 FPR1 NM_0020 38.89 94.38 43.40 0.46 38.89 81.06 12.66 0.16 202454_s_at 2065 ERBB3 NM_0019 13.28 24.46 11.25 0.46 13.28 28.89 6.04 0.21 49306_at 83937 RASSF A1890191 360.79 1084.81 499.14 0.46 360.79 888.19 700.77 203708_at 5142 PDE4B NM_0026 58.60 1193.32 549.36 0.46 58.60 1737.58 1227.97 0.71 222033_s_at 2321 FLT1 AA05882 8.62 13.24 6.10 0.46 8.62 118.67 76.26 0.64 217227xat 3576 IL8 X93006 27.81 51.38 23.68 0.46 27.81 12.34 5.71 211118_x_at 2100 ESR2 AF05142 10.30 23.55 10.87 0.46 10.30 17.60 12.40 0.70 215579_at 60489 APOBE AK02280 11.96 18.83 8.69 0.46 11.96 8.95 5.89 220929_at 26290 GALN NM_0174 39.63 71.97 33.23 0.46 39.63 19.37 43.00 206803_at 5173 PDYN NM_0244 8.32 17.96 8.30 0.46 8.32 5.30 8.56 206222_at 8794 TNFRS NM0038 14.71 41.28 19.10 0.46 14.71 6.75 7.71 203280_at 9667 SAFB2 NM_0146 125.52 214.52 99.28 0.46 125.52 208.35 142.55 0.68 222326_at 5142 PDE4B AW97383 18.87 176.42 81.76 0.46 18.87 279.14 119.85 0.43 205121_at 6443 SGCB NM_0002 23.70 38.32 17.76 0.46 23.70 12.57 16.31 209762_x_at 3431 SP110 AA96919 468.74 833.76 386.51 0.46 468.74 765.75 249.85 0.33 207452 s at 53942 CNTNS NM 0143 36.19 57.53 26.68 0.46 36.19 7.88 32.43 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 214022_s_at 8519 IFITMI AA74910 874.90 1539.56 714.39 0.46 874.90 1337.05 635.82 0.48 206755_at 1555 CYP2B NM_0007 4.36 19.11 8.87 0.46 4.36 4.21 14.45 213661_at 25891 DKFZP A1671186 11.02 33.16 15.41 0.46 11.02 3.37 6.58 215249_at 6165 RPL35 AK02157 12.10 28.30 13.15 0.46 12.10 18.29 8.60 0.47 211219_s_at 9355 LHX2 U11701 225.70 630.33 293.00 0.46 225.70 460.75 278.41 0.60 220533 at NM 0248 10.11 28.88 13.44 0.47 10.11 32.85 40.91 217199sat 6773 STAT2 S81491 28.74 51.90 24.17 0.47 28.74 13.82 59.58 221585_at 27092 CACN BO00450 5.44 11.27 5.25 0.47 5.44 3.30 9.45 201387_s_at 7345 UCHL1 NM_0041 5.97 16.79 7.85 0.47 5.97 7.00 17.94 207449sat 23275 POFUT NM 0152 52.68 88.49 41.37 0.47 52.68 40.11 51.73 211140sat 835 CASP2 AF31417 14.11 25.56 11.97 0.47 14.11 9.99 7.62 210368_at 8641 /// PCDH AB00232 73.20 135.23 63.35 0.47 73.20 50.61 35.91 PCDH

205775_at 26240 FAM50 NM_0121 6.53 20.45 9.58 0.47 6.53 14.80 17.01 216788_at AK02556 13.55 40.07 18.78 0.47 13.55 6.93 14.29 216144 at 57485 ATXN7 AL13737 47.45 137.80 64.62 0.47 47.45 36.09 65.50 222221_x_at 10938 EHD1 AY00716 231.46 681.47 319.64 0.47 231.46 1957.26 1792.81 215510_at 2116 ETV2 AV69398 8.22 21.71 10.19 0.47 8.22 4.96 12.44 208218_s_at 91 ACVR1 NM_0203 13.13 43.94 20.62 0.47 13.13 15.63 21.04 217228sat 51666 ASB4 AC00307 7.17 23.45 11.01 0.47 7.17 8.87 25.70 216056 at 960 CD44 AW85155 11.06 40.70 19.11 0.47 11.06 171.10 238.29 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 202800_at 6507 SLC1A NM_0041 152.05 448.31 210.55 0.47 152.05 824.17 299.32 0.36 214443_at 5817 PVR NM_0065 53.62 81.61 38.33 0.47 53.62 62.54 76.33 216172_at AK02511 36.25 123.25 57.94 0.47 36.25 61.07 22.09 0.36 210755_at 3082 HGF U46010 16.65 34.61 16.28 0.47 16.65 8.40 4.12 202908_at 7466 WFS1 NM_0060 34.00 59.20 27.85 0.47 34.00 39.81 28.46 214767sat 126393 HSPB6 AL55104 24.47 44.62 20.99 0.47 24.47 27.92 15.75 219386_s_at 56833 SLAMF NM_0201 64.32 442.58 208.66 0.47 64.32 584.05 158.27 0.27 209037_s_at 10938 EHD1 AW18286 139.26 404.70 190.85 0.47 139.26 1191.93 1352.43 206671_at 6295 SAG NM_0005 14.51 26.75 12.62 0.47 14.51 11.82 32.83 215602_at 221472 FGD2 AK02445 49.51 118.97 56.19 0.47 49.51 98.39 53.13 0.54 216514 at AF20372 21.53 46.21 21.85 0.47 21.53 30.44 19.56 202856_s_at 9123 SLC16 NM_0042 1269.72 2800.24 1324.35 0.47 1269.72 7277.23 5376.38 0.74 220603sat 55784 MCTP2 NM 0183 18.73 33.13 15.67 0.47 18.73 32.04 22.74 0.71 214637_at 5008 OSM BG43703 4.16 10.86 5.14 0.47 4.16 5.28 5.03 214425_at 259 AMBP AV64575 32.90 51.66 24.45 0.47 32.90 16.61 23.54 205606_at 4040 LRP6 NM_0023 37.16 60.59 28.70 0.47 37.16 45.44 28.19 219564_at 3773 KCNJ1 AF15381 2.83 13.33 6.32 0.47 2.83 17.45 3.98 0.23 206478_at 9834 KIAAO NM_0147 13.88 23.21 11.02 0.47 13.88 5.67 20.65 215180_at AL10970 16.61 25.31 12.02 0.47 16.61 9.66 11.54 214996 at AL07929 31.67 88.05 41.85 0.48 31.67 68.26 86.33 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 220648_at 105 ADAR NM_0187 7.46 19.12 9.09 0.48 7.46 11.36 8.22 0.72 210765_at 1434 CSE1L AF05364 51.53 107.34 51.06 0.48 51.53 109.81 75.70 0.69 208100_x_at 10500 SEMA6 NM_0309 6.34 11.80 5.61 0.48 6.34 6.15 6.80 216415_at 55567 DNAH AK02679 9.20 17.60 8.38 0.48 9.20 3.82 4.66 214563_at 5098 PCDH AF15252 29.47 49.54 23.62 0.48 29.47 14.72 47.38 205524_s_at 1404 HAPLN NM_0018 5.65 17.18 8.20 0.48 5.65 14.55 5.42 0.37 214605_x_at 2825 GPR1 AL04699 32.48 80.34 38.37 0.48 32.48 79.88 48.37 0.61 220008_at 79834 KIAA2 NM_0247 7.69 36.58 17.47 0.48 7.69 46.42 28.53 0.61 218687_s_at 56667 MUC13 AW45124 7.96 35.02 16.75 0.48 7.96 31.24 13.47 0.43 202855_s_at 9123 SLC16 AL51391 673.54 1409.55 674.24 0.48 673.54 2626.14 2682.65 217104_at 400410 LOC40 AL10971 109.68 166.79 79.83 0.48 109.68 190.54 158.92 202485_s_at 8932 MBD2 NM_0039 12.05 44.48 21.29 0.48 12.05 10.55 29.58 201649_at 9246 UBE2L NM_0042 567.27 926.03 443.91 0.48 567.27 477.43 372.63 207327_at 2070 EYA4 NM_0041 12.06 18.39 8.81 0.48 12.06 8.07 7.44 219209_at 64135 IFIH1 NM_0221 197.26 930.22 446.15 0.48 197.26 876.21 393.94 0.45 207826_s_at 3399 IDS NM_0021 3.33 11.06 5.31 0.48 3.33 9.21 41.75 222252_x_at 56893 UBQL AK02335 104.84 283.27 135.97 0.48 104.84 142.02 111.97 AFFX- AFFX- 12.24 79.78 38.32 0.48 12.24 47.35 40.10 M27830_3_at M27830_ 219102_at 57333 RCN3 NM_0206 12.95 58.47 28.09 0.48 12.95 4.54 11.35 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 215682_at 440792 LOC44 AB05144 10.12 93.67 45.00 0.48 10.12 21.62 16.61 215590_x_at AK02561 6.56 31.30 15.05 0.48 6.56 29.21 10.33 0.35 205088_at 10046 CXorf6 NM_0054 6.61 10.84 5.22 0.48 6.61 486.96 572.08 204907_s_at 602 BCL3 A1829875 83.78 611.50 294.34 0.48 83.78 270.71 261.81 206582_s_at 9289 GPR56 NM_0056 3.92 16.45 7.92 0.48 3.92 8.58 7.70 216911_s_at 23119 HIC2 AL16200 9.93 16.44 7.92 0.48 9.93 4.52 2.50 211053_at 3755 KCNG1 BC00636 2.55 10.37 5.00 0.48 2.55 10.62 24.18 211343sat 1305 COL13 M33653 4.64 14.49 6.98 0.48 4.64 6.67 4.10 Al 215844_at 30000 TNPO2 AK02221 12.77 22.44 10.82 0.48 12.77 31.15 6.82 0.22 206187_at 5739 PTGIR NM_0009 93.00 330.43 159.70 0.48 93.00 273.60 159.75 0.58 53991_at 27147 DENN AA12762 12.23 40.51 19.59 0.48 12.23 39.59 22.72 0.57 221661_at 10864 SLC22 AF21045 5.72 19.06 9.24 0.48 5.72 12.38 7.52 0.61 205470_s_at 11012 KLK11 NM_0068 16.49 61.83 29.99 0.49 16.49 32.70 22.39 0.68 217585_at 51131 PHF11 BE50291 5.90 15.70 7.62 0.49 5.90 9.03 2.60 205139_s_at 10090 UST NM_0057 71.09 288.76 140.13 0.49 71.09 208.76 355.04 207740_s_at 23636 NUP62 NM_0123 646.35 1052.53 511.34 0.49 646.35 552.88 618.76 205833_s_at 25859 PART1 A1770098 4.56 11.18 5.44 0.49 4.56 15.27 8.63 0.56 201641_at 684 BST2 NM_0043 955.76 1772.88 862.77 0.49 955.76 797.12 534.68 213731_s_at 6929 TCF3 A1871234 9.50 29.72 14.47 0.49 9.50 28.25 21.50 222292_at 958 CD40 AW29812 60.18 340.59 165.89 0.49 60.18 178.71 214.24 209419 at 8563 THOCS AB02320 23.64 48.24 23.50 0.49 23.64 21.43 21.17 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 64942_at 387509 GPR15 A1937160 144.39 224.86 109.61 0.49 144.39 246.18 158.83 0.65 205632_s_at 8395 PIP5K1 NM_0035 141.80 413.77 201.74 0.49 141.80 80.53 201.85 209176_at A1332962 20.90 60.56 29.55 0.49 20.90 62.90 32.92 0.52 217610_at 246721 POLR2 AL04787 314.89 551.57 269.11 0.49 314.89 208.18 236.75 220819_at 79981 FRMD1 NM_0249 15.27 23.37 11.41 0.49 15.27 8.10 6.30 207094_at 3577 IL8RA NM_0006 11.49 17.56 8.58 0.49 11.49 4.01 15.00 221671_x_at 28299// IGKC M63438 27.09 348.99 170.52 0.49 27.09 113.73 22.17 0.19 ///

217133_x_at 1555 CYP2B X06399 18.10 48.25 23.59 0.49 18.10 19.72 20.60 206570_s_at 440533 PSG1 NM_0027 11.88 19.06 9.32 0.49 11.88 9.01 7.73 PSG
217657_at 55973 BCAP2 AL58368 56.02 93.16 45.56 0.49 56.02 157.68 81.35 0.52 206901_at 79173 C19orf5 NM_0243 11.67 21.06 10.30 0.49 11.67 12.18 8.56 207324_s_at 1823 DSC1 NM_0049 6.65 10.95 5.36 0.49 6.65 3.38 8.05 214135_at 51208 CLDN1 BE55121 23.44 38.38 18.78 0.49 23.44 39.81 16.77 0.42 210294_at 6892 TAPBP AF06728 80.57 303.94 148.78 0.49 80.57 150.09 149.13 216535_at 57863 IGSF4B AL05021 8.07 22.31 10.93 0.49 8.07 14.44 6.88 0.48 217003_s_at 255926 TMDCI AJ132823 7.30 44.10 21.62 0.49 7.30 21.59 19.46 I

215575_at 9659 PDE4D AU15707 2.77 18.79 9.22 0.49 2.77 15.56 5.20 0.33 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 210690_at 8302 KLRC4 U96845 3.22 12.34 6.05 0.49 3.22 3.38 2.30 221171_at 728621 RP4- NM 0250 45.14 94.75 46.50 0.49 45.14 28.58 53.10 692D3. 30 221723_s_at 57835 SLC4A AF24349 19.17 38.68 18.99 0.49 19.17 31.53 31.28 202307_s_at 6890 TAP1 NM_0005 549.39 2237.13 1098.51 0.49 549.39 965.28 591.09 0.61 220271xat 64800 FLJ235 NM 0227 4.22 11.13 5.47 0.49 4.22 6.84 6.38 208580_x_at 8362 /// HIST1 NM_0219 26.88 73.75 36.27 0.49 26.88 23.42 12.78 213051 at 56829 ZC3HA A1133727 1144.26 2471.16 1215.72 0.49 1144.26 2873.27 1269.58 0.44 204677_at 1003 CDH5 NM_0017 2.77 24.82 12.23 0.49 2.77 14.30 13.89 208060_at 5081 PAX7 NM_0025 19.66 30.54 15.05 0.49 19.66 12.61 28.66 220213_at 128553 TSHZ2 NM_0186 3.84 11.41 5.62 0.49 3.84 6.28 3.43 206675_s_at 6498 SKIL NM_0054 7.55 68.20 33.65 0.49 7.55 88.44 197.32 206503_x_at 5371 PML NM_0026 102.22 171.85 84.92 0.49 102.22 161.85 67.69 0.42 217664_at 23030 JMJD2 AA78052 5.04 20.00 9.88 0.49 5.04 7.97 28.25 210226_at 3164 NR4A1 D85245 23.01 56.41 27.91 0.49 23.01 55.58 21.31 0.38 212977_at 57007 CXCR7 A1817041 31.39 87.50 43.31 0.49 31.39 88.25 56.13 0.64 216002_at 2342 FNTB AU14720 26.61 46.15 22.88 0.50 26.61 14.33 20.52 211731_x_at 10214 SSX3 BC00590 23.89 40.63 20.15 0.50 23.89 45.09 26.86 0.60 219914 at 9427 ECEL1 NM0048 5.82 35.17 17.45 0.50 5.82 19.43 11.41 0.59 40560_at 6909 TBX2 U28049 9.36 23.42 11.65 0.50 9.36 65.63 55.42 201269_s_at 23386 NUDC AB02899 23.91 50.99 25.38 0.50 23.91 20.30 23.97 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 209266sat 64116 SLC39 AW13479 21.35 35.36 17.61 0.50 21.35 10.27 24.45 217515_s_at 779 CACN A1391509 7.48 11.24 5.60 0.50 7.48 17.00 16.99 221377_s_at 11317 RBPSU NM0142 7.14 13.83 6.89 0.50 7.14 3.75 11.79 218223_s_at 51177 PLEKH NM_0162 393.57 1389.26 692.14 0.50 393.57 1535.10 1010.63 0.66 210683_at 4902 NRTN AL16199 15.78 48.19 24.02 0.50 15.78 32.18 33.72 220656_at NM_0185 1.01 24.02 11.98 0.50 1.01 2.47 6.09 218764_at 5583 PRKCH NM 0240 144.61 308.76 154.17 0.50 144.61 184.83 270.13 216248_s_at 4929 NR4A2 S77154 9.04 90.84 45.36 0.50 9.04 81.81 98.06 221913_at 23410 SIRT3 A1492888 48.04 91.84 45.86 0.50 48.04 55.01 43.95 216848_at 85374 KIAA1 AB05144 6.70 10.32 5.16 0.50 6.70 4.77 3.20 206955_at 364 AQP7 NM_0011 21.77 57.17 28.56 0.50 21.77 22.61 9.49 211866xat 3077 HFE AF07940 14.49 32.13 16.07 0.50 14.49 13.20 11.87 209897_s_at 9353 SLIT2 AF05558 14.59 45.64 22.83 0.50 14.59 66.77 52.92 205926_at 9466 IL27RA NM_0048 164.31 324.13 162.14 0.50 164.31 876.65 395.74 0.45 216416_at 50807 DDEF1 AK02725 18.77 51.92 25.98 0.50 18.77 10.32 37.77 209305_s_at 4616 GADD AF07807 200.36 512.89 256.94 0.50 200.36 352.50 879.98 212937_s_at 1291 COL6A M20776 69.99 126.27 63.26 0.50 69.99 148.85 131.90 206720_at 4249 MGAT NM_0024 4.55 11.00 5.52 0.50 4.55 3.84 8.44 219694_at 54491 FAM10 NM_0190 494.90 775.91 389.17 0.50 494.90 307.64 58.14 211660 at 5452 POU2F M36653 72.75 128.97 64.72 0.50 72.75 98.45 141.99 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 211661_x_at 5724 PTAFR M80436 78.00 199.45 100.13 0.50 78.00 173.60 141.87 215700_x_at 9362 CPNE6 AL05039 4.79 13.01 6.53 0.50 4.79 6.10 5.02 222240_s_at 51477 ISYNA AL13774 18.57 36.01 18.08 0.50 18.57 24.49 38.29 213458_at 317662 KIAAO AB02319 0.67 20.68 10.39 0.50 0.67 7.58 1.14 215916_at 1145 CHRN AL15741 8.48 28.07 14.10 0.50 8.48 21.36 14.47 0.68 216173_at AK02536 46.10 136.69 68.68 0.50 46.10 62.41 94.51 222141_at 84861 KLHL2 AK02436 44.89 75.72 38.05 0.50 44.89 31.34 31.06 205127_at 5742 PTGS1 NM_0009 17.10 61.50 30.91 0.50 17.10 56.42 64.33 202446_s_at 5359 PLSCR A1825926 1441.49 2826.59 1420.85 0.50 1441.49 2777.81 1350.95 0.49 208301_at NM_0250 41.19 70.16 35.29 0.50 41.19 80.98 101.32 206341_at 3559 IL2RA NM_0004 10.70 44.28 22.28 0.50 10.70 18.41 9.94 0.54 214613_at 2827 GPR3 AW02408 5.41 36.38 18.32 0.50 5.41 19.67 38.12 210890_x_at 3802 KIR2D U24078 4.51 12.15 6.12 0.50 4.51 2.79 3.99 208569_at 8335 HIST1 NM_0035 46.33 91.91 46.28 0.50 46.33 62.17 40.51 216349_at 341651 LOC34 AL13652 57.66 88.59 44.61 0.50 57.66 61.40 56.83 209811_at 835 CASP2 BC00242 81.74 126.69 63.81 0.50 81.74 68.43 29.30 201422_at 10437 1F130 NM 0063 224.38 359.58 181.11 0.50 224.38 321.71 226.05 216502_at 81875 ISG20L AL09673 7.82 12.41 6.26 0.50 7.82 8.05 5.95 215866_at 1937 EEF1G AK02493 71.63 171.60 86.52 0.50 71.63 129.49 128.65 210017 at 10892 MALT1 AF07052 71.24 164.15 82.79 0.50 71.24 267.72 123.84 0.46 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 205377_s_at 43 ACHE A1190022 5.55 50.30 25.37 0.50 5.55 26.45 8.07 0.31 1438_at 2049 EPHB3 X75208 54.66 82.35 41.57 0.50 54.66 27.75 24.53 60815_at 84820 MGC13 AA60120 170.03 284.91 143.82 0.50 170.03 129.40 111.24 202638_s_at 3383 ICAM1 NM_0002 41.96 1353.52 683.82 0.51 41.96 1508.23 1074.85 0.71 207538_at 3565 IL4 NM 0005 7.37 24.80 12.53 0.51 7.37 14.37 14.07 214354_x_at 6439 SFTPB T91506 11.95 60.19 30.41 0.51 11.95 18.06 31.76 214557_at 10744 PTTG2 NM_0066 8.47 43.99 22.23 0.51 8.47 38.59 10.14 0.26 204927_at 8045 RASSF NM_0034 223.03 352.66 178.34 0.51 223.03 170.41 130.03 211712_s_at 8416 ANXA BC00583 4.10 14.32 7.25 0.51 4.10 36.45 19.06 0.52 204879_at 10630 PDPN NM_0064 43.25 127.99 64.79 0.51 43.25 24.06 50.10 49049_at 196403 DTX3 N92708 10.96 24.73 12.52 0.51 10.96 5.77 4.24 206223_at 22853 LMTK2 NM_0149 33.05 75.91 38.45 0.51 33.05 61.76 52.48 207334_s_at 7048 TGFBR NM_0032 36.11 66.79 33.83 0.51 36.11 13.04 40.21 207447_s_at 25834 MGAT NM_0132 2.15 12.94 6.56 0.51 2.15 23.63 15.80 0.67 216370_s_at 8277 TKTL1 Z49258 5.13 10.24 5.19 0.51 5.13 6.95 4.77 206125_s_at 11202 KLK8 NM_0071 6.98 23.67 12.01 0.51 6.98 16.02 11.44 0.71 219367_s_at 8828 NRP2 NM_0185 12.04 38.01 19.30 0.51 12.04 375.70 261.71 0.70 214185_at 10657 KHDR AW59222 34.55 68.05 34.56 0.51 34.55 82.11 67.59 207050_at 781 CACN NM_0007 6.33 14.14 7.18 0.51 6.33 8.90 9.45 210618_at 5909 RAP1G AB00794 21.45 38.37 19.53 0.51 21.45 9.35 10.69 206970_at 6900 CNTN2 NM_0050 6.76 16.08 8.20 0.51 6.76 13.94 6.67 0.48 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (10ng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (10ng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 206193_s_at 1041 CDSN NM_0012 8.09 19.62 10.00 0.51 8.09 3.99 12.05 207779_at NM_0163 28.62 95.09 48.52 0.51 28.62 15.36 37.54 217142_at 442215 LOC44 AL03568 55.76 158.82 81.04 0.51 55.76 72.88 145.15 220037_s_at 10894 XLKD1 NM_0161 6.56 12.69 6.48 0.51 6.56 4.51 11.84 216815 at AL13630 4.70 26.52 13.54 0.51 4.70 2.68 5.74 210799_at 3351 HTR1B M81590 16.73 88.77 45.33 0.51 16.73 20.33 12.85 219579_at 5866 RAB3I NM_0134 104.83 163.56 83.53 0.51 104.83 47.48 56.29 218543_s_at 64761 PARP1 NM_0227 409.83 726.14 370.96 0.51 409.83 616.31 193.02 0.31 219257sat 8877 SPHK1 NM 0219 82.73 145.13 74.17 0.51 82.73 358.67 603.80 222219_s_at 79816 TLE6 A000776 7.19 25.99 13.29 0.51 7.19 4.94 21.03 220210_at 57053 CHRN NM_0204 28.16 61.66 31.56 0.51 28.16 40.00 58.84 209012_at 7204 TRIO AV71819 47.49 80.66 41.33 0.51 47.49 29.63 36.45 214489_at 2488 FSHB NM_0005 6.22 12.60 6.47 0.51 6.22 22.70 31.42 218015_s_at 56897 WRNIP NM_0201 6.63 34.34 17.64 0.51 6.63 9.00 9.76 205549_at 5121 PCP4 NM_0061 9.85 25.52 13.11 0.51 9.85 4.40 4.32 216062_at 960 CD44 AW85155 10.10 41.48 21.34 0.51 10.10 34.89 36.40 215922_at 85021 REPS1 AL04925 39.46 66.97 34.47 0.51 39.46 30.48 23.61 219562_at 25837 RAB26 NM_0143 13.65 20.86 10.74 0.51 13.65 22.29 25.58 206033_s_at 1825 DSC3 NM_0019 105.27 256.50 132.22 0.52 105.27 117.25 162.66 217476 at 7067 /// THRA M24900 7.74 12.50 6.44 0.52 7.74 6.69 14.37 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (10ng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (10ng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 216123xat 54879 ST7L AK02415 42.11 68.45 35.30 0.52 42.11 35.28 18.38 214689_at 60676 PAPPA BF43515 23.05 50.15 25.88 0.52 23.05 25.00 9.44 214619_at 1394 CRHR1 X72304 11.85 37.23 19.21 0.52 11.85 40.54 41.73 220168_at 55259 CASC1 NM_0182 3.79 11.99 6.20 0.52 3.79 8.01 13.79 207354_at 6360 CCL16 NM_0045 4.37 15.99 8.26 0.52 4.37 5.71 12.10 216465 at AL11020 5.22 17.20 8.91 0.52 5.22 5.84 11.73 215939_at AU14800 7.97 22.86 11.85 0.52 7.97 2.85 12.83 207296_at 79175 ZNF34 NM_0243 6.98 10.70 5.54 0.52 6.98 5.91 7.30 211203_s_at 1272 CNTN1 U07820 16.70 34.79 18.04 0.52 16.70 28.76 18.01 0.63 211873_s_at 56107 PCDH AF15251 4.75 18.31 9.50 0.52 4.75 40.37 10.33 0.26 210355_at 5744 PTHLH J03580 4.74 14.99 7.78 0.52 4.74 17.18 6.60 0.38 216773_at 150684 COMM AK02519 12.54 44.24 22.97 0.52 12.54 23.57 25.61 208485_x_at 8837 CFLAR NM_0038 397.61 1185.98 615.89 0.52 397.61 1197.52 1550.82 201564_s_at 6624 FSCN1 NM_0030 1183.38 3054.04 1586.08 0.52 1183.38 1959.00 1655.62 207113_s_at 7124 TNF NM 0005 524.28 3499.34 1817.81 0.52 524.28 1597.18 2742.44 210133_at 6356 CCL11 D49372 9.12 23.90 12.42 0.52 9.12 27.60 22.50 213329_at 23380 SRGAP AA74226 323.54 543.95 282.78 0.52 323.54 260.56 197.79 212939_at 1291 COL6A M20776 3.32 12.09 6.31 0.52 3.32 9.49 17.66 208476_s_at 55691 FRMD4 NM_0180 37.99 69.80 36.42 0.52 37.99 9.43 6.09 211786_at 3604 TNFRS B000619 4.45 65.67 34.29 0.52 4.45 191.03 111.10 0.58 220337_at 58157 NGB NM_0212 7.98 17.97 9.39 0.52 7.98 8.13 23.16 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 214289_at 5689 PSMB1 W86293 18.85 37.45 19.57 0.52 18.85 49.41 67.72 217290_at AL03099 6.61 12.03 6.29 0.52 6.61 7.72 4.60 209138_x_at 3535 IGL@ M87790 41.80 71.68 37.53 0.52 41.80 59.67 28.54 201631_s_at 8870 IER3 NM_0038 24.79 230.83 120.90 0.52 24.79 847.54 1453.11 216365xat 3535 /// IGL@ AF04724 2.92 10.45 5.48 0.52 2.92 6.15 10.17 CPVL
219352_at 55008 HERC6 NM_0179 174.89 298.58 156.53 0.52 174.89 356.45 121.02 0.34 211817_s_at 3762 KCNJ5 L47208 8.40 36.77 19.28 0.52 8.40 36.80 3.87 0.11 216785_at 2281 FKBP1 AK02627 5.02 15.17 7.96 0.52 5.02 2.52 16.17 209699_x_at 1646 AKR1C U05598 8.15 41.79 21.92 0.52 8.15 76.63 203.90 208047_s_at 4664 NAB1 NM_0059 90.73 196.23 103.05 0.53 90.73 105.29 366.13 207169_x_at 780 DDR1 NM_0019 3.04 11.53 6.06 0.53 3.04 15.09 13.53 47553_at 25861 DFNB3 AA81333 7.91 69.84 36.70 0.53 7.91 61.97 68.52 216544_at 159162 RBMY AC00732 7.25 18.87 9.92 0.53 7.25 12.31 8.38 0.68 221376_at 8822 FGF17 NM_0038 19.98 48.53 25.52 0.53 19.98 52.78 27.56 0.52 216774_at AK02532 32.59 50.41 26.51 0.53 32.59 34.02 29.30 216157 at AK02423 4.73 33.34 17.54 0.53 4.73 9.95 10.40 213299_at 51341 ZBTB7 AW02707 70.22 108.67 57.16 0.53 70.22 40.69 32.44 219117_s_at 51303 FKBP1 NM_0165 225.15 376.30 197.96 0.53 225.15 248.89 180.36 219432_at 2121 EVC NM_0145 10.39 22.76 11.97 0.53 10.39 4.02 7.30 209039_x_at 10938 EHD1 AF00143 331.25 1308.87 689.60 0.53 331.25 3816.89 2980.02 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 206459_s_at 7482 WNT2 NM_0244 9.02 34.17 18.02 0.53 9.02 6.66 17.72 201473_at 3726 JUNG NM_0022 220.42 845.97 446.37 0.53 220.42 502.08 765.28 216187xat 3831 KNS2 AF22269 1842.32 4024.28 2124.02 0.53 1842.32 2025.86 2088.13 202995_s_at 2192 FBLN1 NM_0064 45.62 83.27 43.98 0.53 45.62 19.19 51.05 208906_at 221092 BSCL2 BC00491 234.80 397.20 209.88 0.53 234.80 321.30 214.35 HNRP

35147_at 23263 MCF2L AB00236 6.16 20.79 10.99 0.53 6.16 13.67 7.39 0.54 211924_s_at 5329 PLAUR AY02918 381.08 1022.12 540.21 0.53 381.08 1224.36 1708.63 210222_s_at 6252 RTN1 BC00031 18.29 38.69 20.47 0.53 18.29 39.32 25.70 0.65 220958_at 54986 ULK4 NM_0178 9.09 15.24 8.07 0.53 9.09 4.03 9.08 220167sat 24150 // TP53T NM 0153 23.33 48.72 25.83 0.53 23.33 29.66 36.24 LOCI
219863_at 51191 HERCS NM_0163 101.11 168.99 89.63 0.53 101.11 136.43 81.59 202254_at 26037 SIPAIL AB00790 11.87 34.70 18.42 0.53 11.87 57.47 23.61 0.41 219993_at 64321 SOX17 NM_0224 8.76 35.15 18.67 0.53 8.76 20.92 30.74 207547sat 11170 FAM10 NM 0071 11.27 27.99 14.87 0.53 11.27 45.91 34.03 0.74 202914_s_at 9826 ARHG NM_0147 118.53 206.46 109.77 0.53 118.53 159.19 93.28 219992_at 6866 TAC3 NM_0132 72.37 128.12 68.17 0.53 72.37 150.39 101.60 0.68 210845_s_at 5329 PLAUR U08839 649.50 1163.57 619.52 0.53 649.50 1604.51 1884.17 219196_at 29106 SCG3 NM_0132 3.94 15.34 8.17 0.53 3.94 18.72 2.40 0.13 219410 at 55076 TMEM NM 0180 442.15 965.75 514.69 0.53 442.15 1335.48 1180.69 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 217557_s_at AV71035 38.92 76.27 40.65 0.53 38.92 137.55 37.00 0.27 216167_at 10446 LRRN5 AK02486 2.86 13.71 7.31 0.53 2.86 8.82 2.15 205288_at 8556 CDC14 NM_0036 29.31 82.96 44.31 0.53 29.31 58.73 56.67 213678_at 441151 C6orfl3 F09448 28.04 42.44 22.67 0.53 28.04 26.23 28.17 218686_s_at 64285 RHBDF NM_0224 170.51 261.98 139.95 0.53 170.51 203.45 155.07 209119_x_at 7026 NR2F2 AV70346 3.53 25.01 13.36 0.53 3.53 59.63 34.63 0.58 117 at 3310 HSPA6 X51757 48.01 100.16 53.54 0.53 48.01 54.27 67.74 208223_s_at 91 ACVR1 NM_0203 28.94 56.75 30.34 0.53 28.94 35.26 17.15 221651_x_at 28299 // IGKC BC00533 56.33 325.62 174.17 0.53 56.33 131.91 31.89 0.24 208013_s_at 56 ACRV1 NM_0201 37.63 59.59 31.88 0.53 37.63 27.80 14.74 214891_at 23014 FBXO2 U79257 8.02 14.28 7.65 0.54 8.02 7.88 4.75 214417_s_at 26998 FETUB N39010 21.05 48.29 25.86 0.54 21.05 24.61 42.55 205080_at 5915 RARB NM_0009 31.70 70.57 37.84 0.54 31.70 15.93 26.32 221011_s_at 81606 LBH NM_0309 75.88 125.33 67.22 0.54 75.88 80.47 125.37 221902_at 387509 GPR15 AL56794 51.24 78.75 42.24 0.54 51.24 111.54 64.70 0.58 206841_at 5149 PDE6H NM_0062 7.26 25.62 13.75 0.54 7.26 31.56 21.70 0.69 217600_at 222663 SCUBE BF51167 32.40 55.52 29.86 0.54 32.40 29.49 21.40 203904_x_at 3732 CD82 NM_0022 190.04 419.57 225.84 0.54 190.04 1212.74 673.84 0.56 213172 at 23508 TTC9 AW23560 2.78 10.65 5.74 0.54 2.78 5.88 3.78 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 210933_s_at 6624 FSCN1 BC00490 1177.05 2869.97 1548.32 0.54 1177.05 1368.41 1629.56 217650_x_at 6483 /// ST3GA A1088162 164.40 550.85 297.22 0.54 164.40 671.65 399.21 0.59 216315_x_at 387522 UBE2V AL12187 49.77 89.94 48.58 0.54 49.77 83.11 60.79 0.73 Kua-UEV

210705_s_at 85363 TRIMS AF22002 80.81 147.13 79.55 0.54 80.81 71.29 32.48 213607xat 65220 NADK BE55134 274.21 424.56 229.72 0.54 274.21 137.52 193.88 218675_at 51310 SLC22 NM_0203 10.21 17.21 9.33 0.54 10.21 39.31 3.90 0.10 211965_at 677 ZFP36L BE62091 56.38 95.87 51.99 0.54 56.38 65.97 62.81 215391_at 4130 MAP1 AA63362 7.41 15.36 8.33 0.54 7.41 19.80 10.42 0.53 205976_at 22868 FASTK NM_0149 48.86 80.50 43.68 0.54 48.86 73.66 54.61 0.74 206561_s_at 57016 AKR1B NM_0202 11.56 28.31 15.37 0.54 11.56 22.33 24.19 209124 at 4615 MYD88 U70451 1576.46 2487.91 1351.39 0.54 1576.46 1687.04 587.50 206382_s_at 627 BDNF NM_0017 7.01 15.96 8.67 0.54 7.01 11.11 12.87 203849_s_at 547 KIF1A NM 0043 14.79 24.79 13.47 0.54 14.79 4.51 36.08 AFFX-BioB- AFFX- 447.16 784.04 426.26 0.54 447.16 424.02 283.64 3 -at BioB-3 217433_at 6867 TACC1 AB02902 6.98 19.88 10.81 0.54 6.98 21.66 10.39 0.48 212611_at 23220 DTX4 AV72852 186.62 699.08 380.35 0.54 186.62 440.08 335.05 210873_x_at 200315 APOBE U03891 4.78 44.43 24.18 0.54 4.78 165.32 25.92 0.16 215904 at 4301 MLLT4 AL04969 1.15 26.08 14.20 0.54 1.15 7.82 19.30 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 202662_s_at 3709 ITPR2 NM_0022 94.29 154.21 84.03 0.54 94.29 93.41 125.45 205935_at 2294 FOXF1 NM0014 27.17 45.28 24.67 0.54 27.17 77.08 64.65 217277 at AL00872 14.95 43.89 23.94 0.55 14.95 28.64 29.82 211531xat 5542 /// PRB 1 K03205 73.74 118.31 64.57 0.55 73.74 67.31 43.24 220710_at 80035 C15orf2 NM_0249 87.22 207.09 113.09 0.55 87.22 91.82 117.64 205569_at 27074 LAMPS NM_0143 2.47 124.33 67.95 0.55 2.47 5996.80 1210.41 0.20 206255_at 640 BLK NM_0017 2.15 10.69 5.84 0.55 2.15 3.75 2.77 215811_at 6622 SNCA AF23887 6.72 30.01 16.41 0.55 6.72 3.29 6.46 207670_at 3891 KRT85 NM_0022 20.89 47.79 26.18 0.55 20.89 28.78 22.04 215284 at 51429 SNX9 AF07057 23.02 53.74 29.46 0.55 23.02 17.55 22.15 210578_at 10107 TRIM1 AF22012 24.21 50.62 27.75 0.55 24.21 26.88 20.04 207526_s_at 9173 IL1RL1 NM_0038 10.85 18.10 9.93 0.55 10.85 6.03 3.98 221905_at 1540 CYLD BF51643 82.52 405.95 222.84 0.55 82.52 216.75 159.34 0.74 216499 at AL13759 21.45 105.17 57.74 0.55 21.45 47.06 69.81 215550_at 9901 SRGAP AL13745 23.64 84.50 46.42 0.55 23.64 17.94 40.98 210433_at 23509 POFUT BO00058 13.87 54.44 29.91 0.55 13.87 23.05 42.46 37512_at 8630 HSD17 U89281 14.46 29.98 16.48 0.55 14.46 29.73 20.67 0.70 217235_x_at D84140 36.97 89.71 49.32 0.55 36.97 49.06 25.02 210743_s_at 8556 CDC14 AF06410 65.42 112.10 61.62 0.55 65.42 63.56 26.99 205744_at 8448 DOC2A NM 0035 49.94 77.70 42.74 0.55 49.94 55.52 55.74 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) AFFX- AFFX- 100.84 176.11 96.90 0.55 100.84 51.70 212.23 HUMRGE/M HUMRG
10098_5_at E/M1009 207928_s_at 8001 GLRA3 NM_0065 2.26 13.80 7.59 0.55 2.26 2.02 2.85 205425_at 3092 HIP1 NM_0053 203.31 395.38 217.94 0.55 203.31 214.11 196.43 204980_at 9575 CLOC NM_0048 271.80 435.45 240.07 0.55 271.80 464.62 220.13 0.47 213362_at 5789 PTPRD N73931 17.26 31.03 17.12 0.55 17.26 8.46 21.60 219480_at 6615 SNAIL NM_0059 55.89 160.37 88.48 0.55 55.89 159.78 157.05 216265_x_at 4625 MYH7 A1292276 1.73 13.20 7.28 0.55 1.73 3.32 10.19 220073_s_at 55200 PLEKH NM_0181 26.25 53.79 29.70 0.55 26.25 7.48 27.49 206699_x_at 4861 NPAS1 NM_0025 8.54 18.47 10.20 0.55 8.54 21.49 5.57 0.26 221898_at 10630 PDPN AU15445 66.68 153.19 84.64 0.55 66.68 19.34 43.79 202222_s_at 1674 DES NM_0019 29.18 62.95 34.80 0.55 29.18 20.71 37.45 216372_at AF10329 5.55 34.13 18.87 0.55 5.55 8.29 15.86 219853_at 79147 FKRP BC00261 12.33 67.30 37.22 0.55 12.33 47.93 55.53 51226_at N53536 26.09 42.12 23.29 0.55 26.09 13.40 11.21 210197_at 3705 ITPK1 BC00362 11.15 24.41 13.50 0.55 11.15 8.20 8.34 220752_at 51145 LOC51 NM_0161 11.12 36.72 20.31 0.55 11.12 21.35 6.78 0.32 207461 at NM 0012 15.57 27.78 15.37 0.55 15.57 16.05 3.46 216984xat 3535 IGL@ D84143 4.91 13.58 7.51 0.55 4.91 7.88 15.03 214904_at 7592 ZNF41 A1927984 28.59 53.02 29.34 0.55 28.59 35.44 25.29 204363 at 2152 F3 NM 0019 224.43 764.37 423.36 0.55 224.43 371.32 748.25 204958 at 1263 PLK3 NM 0040 55.80 180.65 100.24 0.55 55.80 298.27 1262.77 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 211315_s_at 8913 CACN AB 01204 4.82 23.79 13.20 0.55 4.82 11.24 12.00 205888_s_at 23040 // JAKMI A1962693 5.51 17.36 9.64 0.56 5.51 4.54 2.70 214516_at 8366 HIST1 NM_0035 4.22 23.10 12.83 0.56 4.22 23.87 10.37 0.43 215221_at 27086 FOXP1 AK02506 226.27 401.58 223.02 0.56 226.27 180.79 183.70 205262_at 3757 KCNH2 NM_0002 7.98 139.77 77.73 0.56 7.98 25.24 5.72 0.23 217024_x_at 140885 SIRPA AC00483 69.21 194.86 108.36 0.56 69.21 85.81 170.74 215387_x_at 10082 GPC6 AK02150 68.22 142.87 79.46 0.56 68.22 89.10 26.94 220711_at NM 0249 77.24 144.22 80.23 0.56 77.24 87.96 91.39 210230_at 728965 LOC72 BC00362 653.12 1704.32 948.25 0.56 653.12 1578.41 1354.99 203394_s_at 3280 HES1 BE97368 11.64 26.95 15.01 0.56 11.64 41.23 28.61 0.69 202545_at 5580 PRKCD NM_0062 1738.33 3145.25 1752.71 0.56 1738.33 2390.31 2411.49 206973_at 8499 PPFIA2 NM_0036 15.84 124.67 69.49 0.56 15.84 76.28 98.64 217179_x_at 96610 LOC96 X79782 9.33 25.97 14.47 0.56 9.33 40.96 32.12 218810_at 80149 ZC3H1 NM_0250 120.05 822.86 458.68 0.56 120.05 1177.82 2182.59 212091_s_at 1291 COL6A A1141603 135.96 364.34 203.09 0.56 135.96 674.75 506.24 207987_s_at 2796 GNRH1 NM_0008 9.00 36.96 20.60 0.56 9.00 25.18 49.24 214128_at 747 CIIorfl AB01455 72.53 114.27 63.79 0.56 72.53 129.18 104.34 222114_x_at 54853 WDR55 BE40999 31.53 48.60 27.15 0.56 31.53 29.37 17.55 206966 s at 11278 KLF12 NM_0162 56.94 103.37 57.80 0.56 56.94 39.40 41.11 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 217270_s_at 9149 DYRK1 AC00539 28.10 42.38 23.70 0.56 28.10 31.73 20.31 206780_at 2572 GAD2 NM_0008 26.45 50.02 27.97 0.56 26.45 32.32 23.56 219227_at 79616 CCNJL NM0245 3.73 29.44 16.48 0.56 3.73 79.41 75.44 205346_at 6483 ST3GA NM_0069 62.50 220.88 123.65 0.56 62.50 161.43 126.83 216813 at AL51272 3.95 22.37 12.53 0.56 3.95 7.16 28.67 206100_at 1368 CPM NM_0018 1155.85 3121.43 1748.94 0.56 1155.85 5890.11 2966.29 0.50 220374_at 54813 BTBD5 NM_0176 13.47 55.62 31.17 0.56 13.47 39.98 28.82 0.72 207025_at 57165 GJA12 NM_0204 16.01 37.12 20.81 0.56 16.01 25.71 35.71 216812_at AF30829 2.62 13.46 7.55 0.56 2.62 5.61 8.83 215149_at AF05210 14.42 29.68 16.64 0.56 14.42 14.76 14.35 204621_s_at 4929 NR4A2 A1935096 33.55 73.04 40.95 0.56 33.55 127.15 80.23 0.63 216147_at 55752 11-Sep AL35394 23.66 232.22 130.20 0.56 23.66 112.72 192.96 38037_at 1839 HBEGF M60278 53.04 83.15 46.62 0.56 53.04 148.66 126.52 207093_s_at 4974 OMG NM_0025 43.54 80.98 45.41 0.56 43.54 55.02 36.52 206191_at 956 ENTPD NM_0012 9.27 17.66 9.91 0.56 9.27 20.77 9.67 0.47 218801_at 55757 UGCG NM_0201 110.85 169.53 95.15 0.56 110.85 126.67 139.82 219752_at 8437 RASAL NM_0046 31.29 66.68 37.43 0.56 31.29 13.95 20.90 220137_at 54621 FLJ206 NM_0190 76.53 137.23 77.05 0.56 76.53 74.70 67.30 207630sat 1390 CREM NM0018 114.54 194.88 109.43 0.56 114.54 211.42 224.82 207007 at 9970 NR1I3 NM_0051 7.81 57.54 32.33 0.56 7.81 23.95 18.69 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 217212_s_at 3581 /// IL9R /// Z84723 35.78 81.25 45.65 0.56 35.78 57.74 51.02 210726_at 1576 CYP3A J04449 12.41 41.65 23.41 0.56 12.41 8.08 19.72 219400_at 8506 CNTN NM_0036 20.59 41.58 23.37 0.56 20.59 47.40 23.08 0.49 221653_x_at 23780 APOL2 BC00439 69.69 106.76 60.03 0.56 69.69 49.07 20.89 206648_at 51276 ZNF57 NM_0165 12.62 31.85 17.92 0.56 12.62 28.30 27.06 217141_at 55727 BTBD7 AL04939 31.90 83.12 46.80 0.56 31.90 27.25 47.58 206209_s_at 762 CA4 NM_0007 20.90 43.68 24.61 0.56 20.90 3.71 17.64 221681_s_at 1834 DSPP AF09450 17.38 57.96 32.67 0.56 17.38 25.33 27.25 AFFX- 6772 STAT1 AFFX- 1011.38 1734.07 978.40 0.56 1011.38 1278.43 866.67 IM97935_3_at F3A/M97 935_3 217541_x_at 125893 LOC12 BG29053 82.50 138.83 78.39 0.56 82.50 70.12 41.45 210601_at 1004 CDH6 BO00001 6.61 16.90 9.54 0.56 6.61 13.62 7.58 0.56 AFFX-r2-Ec- AFFX-r2- 677.00 1126.52 636.20 0.56 677.00 628.74 410.49 bioB-M_at Ec-bioB -M
205723 at 1271 CNTFR NM 0018 37.14 124.98 70.61 0.56 37.14 75.70 97.83 37566_at 23349 KIAA1 AB02896 7.74 31.79 17.97 0.57 7.74 40.64 17.20 0.42 217778 at 27173 SLC39 NM0144 323.99 551.36 311.62 0.57 323.99 304.88 225.76 Al 37 214445 at 22936 ELL2 NM0120 11.49 25.86 14.62 0.57 11.49 6.72 44.76 205303_at 3764 KCNJ8 BF51415 3.75 14.59 8.26 0.57 3.75 5.67 9.91 215513 at 57061 HYMA AF24153 88.17 181.76 102.86 0.57 88.17 181.58 199.14 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) AFFX-BioB- AFFX- 733.24 1184.42 670.42 0.57 733.24 612.06 377.41 Mat BioB-M

216565_x_at 391020 LOC39 AL12199 301.64 510.32 288.88 0.57 301.64 192.14 225.44 214230_at 998 CDC42 R37664 5.92 22.80 12.92 0.57 5.92 5.70 21.06 205265_s_at 10290 SPEG NM_0058 15.45 30.76 17.42 0.57 15.45 14.02 26.29 215421_at A1821657 27.25 45.53 25.79 0.57 27.25 47.99 21.39 0.45 216810_at 85287 KRTAP AJ406939 4.49 15.30 8.67 0.57 4.49 19.39 19.83 211549_s_at 3248 HPGD U63296 6.87 10.78 6.11 0.57 6.87 3.08 21.19 221978_at 3134 HLA-F BE13882 43.93 80.39 45.71 0.57 43.93 60.69 61.09 216322_at 965 CD58 D28586 29.83 46.82 26.63 0.57 29.83 74.55 33.15 0.44 215661_at 23139 MAST2 AK02535 12.29 40.70 23.15 0.57 12.29 15.76 24.58 206286_s_at 6997 /// TDGF1 NM_0032 12.89 20.90 11.90 0.57 12.89 20.82 5.05 0.24 211436_at AF13005 4.74 11.97 6.81 0.57 4.74 9.80 1.09 221329 at 23538 OR52A NM 0123 17.32 33.04 18.81 0.57 17.32 5.16 14.84 210605_s_at 4240 MFGE8 BC00361 49.85 90.54 51.56 0.57 49.85 33.15 20.67 207868_at 1135 CHRN NM_0007 58.88 89.58 51.01 0.57 58.88 64.98 52.14 220232_at 79966 SCDS NM_0249 116.44 257.09 146.48 0.57 116.44 112.90 121.68 211232_x_at 2740 GLP1R L23503 5.80 13.69 7.80 0.57 5.80 6.15 9.21 210841_s_at 8828 NRP2 AF28054 47.60 97.39 55.50 0.57 47.60 98.87 135.69 206682_at 10462 CLEC1 NM_0063 46.54 84.46 48.17 0.57 46.54 28.26 18.35 AFFX-BioB- AFFX- 471.26 804.59 459.65 0.57 471.26 471.94 322.91 5 -at BioB-5 214984_at 23049 // SMG1 AO00300 13.67 40.98 23.43 0.57 13.67 28.19 11.93 0.42 OKFZ

EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa TMAA TMAA Control LPS TMAA TMAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 214137_at 5795 PTPRJ A1806482 12.88 33.65 19.24 0.57 12.88 26.53 25.52 204438 at 414308 MRC1 NM 0024 7.79 12.12 6.94 0.57 7.79 9.37 8.37 218425_at 54476 TRIAD BC00078 363.64 594.58 340.41 0.57 363.64 374.30 369.69 205092_x_at 22890 ZBTB1 NM_0149 18.37 37.65 21.56 0.57 18.37 42.10 59.26 207575_at 342096 GOLG NM_0186 15.87 29.29 16.77 0.57 15.87 5.57 18.62 GOLG

216191_s_at 64919 // TRA@ X72501 0.96 17.62 10.10 0.57 0.96 7.13 5.41 TRD @

B

205153sat 958 CD40 NM0012 264.54 1239.11 710.48 0.57 264.54 1797.70 1931.70 210804_x_at 6546 SLC8A AF12852 42.68 67.98 38.99 0.57 42.68 16.40 14.98 209525_at 50810 HDGF BG28501 3.78 10.56 6.06 0.57 3.78 1.75 3.52 207194_s_at 3386 ICAM4 NM_0015 20.19 47.25 27.12 0.57 20.19 29.54 17.25 206766_at 8515 ITGA1 AF11234 53.44 109.42 62.86 0.57 53.44 52.56 55.10 AFFX-BioC- AFFX- 1489.47 2318.83 1332.44 0.57 1489.47 1341.35 937.98 5 -at BioC-5 204287_at 9145 SYNG NM0047 46.52 71.02 40.83 0.57 46.52 36.47 76.27 203595_s_at 24138 IFITS N47725 27.91 198.45 114.11 0.58 27.91 239.63 98.57 0.41 206508_at 970 CD70 NM_0012 877.18 3190.96 1835.10 0.58 877.18 1948.79 1672.51 201750 s at 1889 ECE1 NM_0013 20.76 76.46 44.00 0.58 20.76 182.20 191.67 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 215498_s_at 5606 MAP2 AA78038 179.29 518.27 298.30 0.58 179.29 985.59 1021.49 203242_s_at 10611 PDLIM BG05455 260.99 593.87 342.05 0.58 260.99 265.58 464.58 217201_at 9462 RASAL AB00797 22.70 64.09 36.92 0.58 22.70 54.47 30.33 0.56 220771_at 51152 LOC51 NM_0161 38.29 73.33 42.26 0.58 38.29 42.00 42.67 220272_at 54796 BNC2 NM0176 24.44 38.36 22.11 0.58 24.44 12.21 5.86 220905_at NM_0250 16.72 62.26 35.90 0.58 16.72 51.93 24.26 0.47 207312_at 5260 PHKG1 NM_0062 32.44 59.02 34.07 0.58 32.44 9.42 50.25 211407_at 4713 NDUF M33374 25.58 53.84 31.10 0.58 25.58 34.20 20.41 206539_s_at 66002 CYP4F NM_0239 11.43 79.74 46.06 0.58 11.43 19.47 17.14 210173_at 5795 PTPRJ D37781 79.43 119.78 69.22 0.58 79.43 40.66 106.77 204654_s_at 7020 TFAP2 NM_0032 9.12 114.94 66.47 0.58 9.12 217.09 225.23 216072_at 3275 PRMT2 AL05006 11.83 34.17 19.76 0.58 11.83 36.46 3.50 0.10 214707xat 7840 ALMS1 AB00232 100.13 414.70 239.87 0.58 100.13 127.94 81.47 215627_at 440925 LOC44 AK02351 19.11 53.40 30.93 0.58 19.11 48.09 14.09 0.29 208596_s_at 54575 // UGT1A NM_0190 7.00 15.77 9.13 0.58 7.00 13.37 16.34 207375_s_at 3601 IL15RA NM_0021 71.76 121.46 70.36 0.58 71.76 245.72 303.93 202637_s_at 3383 ICAM1 A1608725 37.89 1474.78 854.57 0.58 37.89 1749.04 1165.92 0.67 207718_x_at 1548 /// CYP2A NM_0007 26.66 46.31 26.84 0.58 26.66 51.38 24.89 0.48 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 209785_s_at 8605 PLA2G AF06521 128.84 631.78 366.27 0.58 128.84 654.05 528.35 206999_at 3595 IL12RB NM_0015 1114.24 1860.35 1078.75 0.58 1114.24 1418.15 1004.03 209886_s_at 4091 SMAD AF03552 20.93 52.85 30.66 0.58 20.93 13.94 17.92 219869_s_at 64116 SLC39 AW13975 736.35 1327.90 770.56 0.58 736.35 1684.93 1731.26 212503_s_at 22982 DIP2C N22859 10.57 27.11 15.73 0.58 10.57 12.39 20.14 211371_at 5607 MAP2 U71088 3.85 10.74 6.24 0.58 3.85 6.96 12.59 214424sat AV65085 4.23 11.25 6.53 0.58 4.23 7.40 4.06 205241_at 9997 SCO2 NM_0051 454.58 968.47 562.22 0.58 454.58 1567.77 688.65 0.44 209493_at 23037 PDZD2 AF33865 4.64 22.46 13.04 0.58 4.64 17.01 5.43 0.32 207733xat 5678 PSG9 NM0027 14.26 42.81 24.89 0.58 14.26 13.42 4.78 215555_at 57035 Clorf63 AU15844 42.37 171.04 99.46 0.58 42.37 43.08 61.25 207667_s_at 5606 MAP2 NM_0027 220.08 487.84 283.74 0.58 220.08 531.34 1158.48 203729_at 2014 EMP3 NM_0014 2819.63 5234.38 3044.73 0.58 2819.63 5665.66 5895.52 221866_at 7942 TFEB AL03558 238.25 397.89 231.47 0.58 238.25 341.25 296.07 211862_x_at 8837 CFLAR AF01545 409.00 1233.50 717.66 0.58 409.00 1333.04 1749.55 222040_at 3178 /// HNRP A1144007 165.78 276.66 161.00 0.58 165.78 416.16 350.46 Al ///

205225_at 2099 ESR1 NM_0001 2.14 17.41 10.13 0.58 2.14 3.98 8.51 219794_at 55275 VPS53 NM_0182 49.29 87.53 50.94 0.58 49.29 31.43 61.86 217200 x at 1534 CYB56 U06715 167.13 257.90 150.23 0.58 167.13 224.54 146.87 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa TMAA TMAA Control LPS TMAA TMAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 205801_s_at 25780 RASGR NM_0153 3.46 13.15 7.66 0.58 3.46 3.17 1.50 217208_s_at 1739 /// DLG1 AL12198 220.18 355.90 207.43 0.58 220.18 148.54 153.67 TNFRS

217704_x_at 440423 SUZ12 A1820796 289.95 583.77 340.31 0.58 289.95 258.87 278.56 P
208965_s_at 3428 1F116 BG25667 341.07 521.43 303.99 0.58 341.07 319.55 157.68 206538_at 22808 MRAS NM_0122 56.09 95.39 55.62 0.58 56.09 133.55 143.15 211012_s_at 161527 PML /// BC00008 130.51 223.62 130.43 0.58 130.51 277.30 61.72 0.22 203882_at 10379 ISGF3 NM_0060 553.66 1503.24 877.98 0.58 553.66 1354.94 1005.75 0.74 207998_s_at 776 CACN NM_0007 6.39 13.31 7.78 0.58 6.39 8.64 18.29 206339_at 9607 CARTP NM_0042 28.40 49.14 28.75 0.58 28.40 40.01 24.85 205174_s_at 25797 QPCT NM_0124 60.94 236.11 138.15 0.59 60.94 309.07 161.82 0.52 204902_s_at 23192 // ATG4B NM_0133 96.08 152.52 89.25 0.59 96.08 200.99 111.85 0.56 210282_at 7750 ZMYM AL13662 49.96 95.03 55.68 0.59 49.96 115.43 64.80 0.56 220484 at 55283 MCOL NM 0182 374.54 824.00 482.88 0.59 374.54 615.67 1008.13 211802_x_at 8913 CACN AF22775 17.00 34.12 20.00 0.59 17.00 17.98 18.23 209016_s_at 3855 KRT7 BC00270 8.76 51.50 30.19 0.59 8.76 43.08 29.90 0.69 221755_at 254102 EHBP1 BG33419 381.85 698.02 409.19 0.59 381.85 124.69 219.63 206995_x_at 8578 SCARF NM_0036 29.69 49.43 28.99 0.59 29.69 80.71 81.92 204682 at 4053 LTBP2 NM_0004 41.55 69.71 40.90 0.59 41.55 25.89 46.87 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 221440_s_at 10741 RBBP9 NM_0066 8.25 18.93 11.12 0.59 8.25 19.01 18.60 214058_at 4610 MYCL M19720 299.15 821.66 482.94 0.59 299.15 298.31 216.24 211552sat 8659 ALDH4 U24267 25.77 40.80 23.99 0.59 25.77 14.35 24.14 Al 217054_at AF00719 20.63 52.61 30.93 0.59 20.63 15.92 18.64 206850_at 10633 RRP22 NM_0064 55.76 100.63 59.20 0.59 55.76 205.20 295.67 215425_at 10950 BTG3 AL04933 20.75 44.40 26.13 0.59 20.75 30.33 21.44 216432_at 9153 SLC28 AK02512 5.99 12.07 7.11 0.59 5.99 12.71 2.85 0.22 215496 at 23034 SAMD AL11752 11.78 32.17 18.94 0.59 11.78 30.63 40.68 210594_x_at 9019 MPZL1 AF23975 53.60 110.93 65.33 0.59 53.60 35.30 91.06 219411 at 79767 ELMO3 NM0247 63.48 103.14 60.74 0.59 63.48 117.35 113.52 203441_s_at 1000 CDH2 NM_0017 56.46 87.33 51.56 0.59 56.46 53.16 80.65 211653_x_at 1646 AKR1C M33376 25.79 59.50 35.14 0.59 25.79 62.69 198.51 211571sat 1462 CSPG2 D32039 91.45 197.62 116.73 0.59 91.45 143.81 123.83 214590sat 7321 UBE2D AL54576 25.37 41.26 24.37 0.59 25.37 36.59 44.37 206830_at 57282 SLC4A NM_0220 8.17 18.16 10.72 0.59 8.17 10.63 2.69 216745xat AK02460 114.85 201.71 119.18 0.59 114.85 130.79 82.49 211668sat 5328 PLAU K03226 177.67 396.21 234.14 0.59 177.67 579.34 2489.29 AFFX-r2-Ec- AFFX-r2- 1801.29 2723.74 1610.18 0.59 1801.29 1638.71 976.91 bioC-5 at Ec-bioC-5 210364_at 6327 SCN2B U87555 5.28 38.85 22.97 0.59 5.28 18.91 12.20 0.64 208504_x_at 56125 PCDHB NM_0189 10.82 21.09 12.47 0.59 10.82 7.45 5.04 214068 at 146227 BEAN AF07061 20.28 31.31 18.53 0.59 20.28 4.38 23.37 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 203141_s_at 8546 AP3B1 NM_0036 161.30 242.06 143.30 0.59 161.30 100.15 153.71 206132_at 4163 MCC NM_0023 33.27 67.28 39.85 0.59 33.27 51.38 70.01 221920_s_at 51312 SLC25 BE67776 209.09 337.45 200.01 0.59 209.09 78.66 217.19 215868_x_at 6660 SOXS AK02623 38.29 63.01 37.35 0.59 38.29 143.81 82.81 0.58 216964_at AL16208 26.50 49.35 29.25 0.59 26.50 29.39 32.70 215385_at 79068 FTO AK02247 114.44 203.90 120.88 0.59 114.44 93.30 83.09 218631_at 60370 AVPI1 NM_0217 59.68 108.10 64.08 0.59 59.68 252.57 159.91 0.63 214724_at 85458 DIXDC AF07062 101.05 314.69 186.64 0.59 101.05 991.37 525.56 0.53 217259 at AL11754 24.30 40.75 24.18 0.59 24.30 12.24 20.98 208167_s_at 4325 MMP16 NM_0225 6.60 22.80 13.54 0.59 6.60 5.44 7.73 201308_s_at 55752 11-Sep NM_0182 137.44 234.40 139.25 0.59 137.44 130.93 250.19 204901_at 8945 BTRC AA82436 6.95 34.26 20.36 0.59 6.95 16.62 30.25 211208_s_at 8573 CASK AB03932 40.01 96.46 57.33 0.59 40.01 24.58 64.81 213693_s_at 4582 MUC1 A1610869 326.98 699.61 416.00 0.59 326.98 446.59 298.14 200760_s_at 10550 ARL6I N92494 2140.43 3933.07 2338.70 0.59 2140.43 2566.86 973.29 216154_at 2262 GPC5 AF33978 7.03 33.40 19.88 0.60 7.03 2.65 5.02 206423_at 10218 ANGPT NM_0211 6.35 16.98 10.11 0.60 6.35 3.05 10.19 221103_s_at 55779 WDR52 NM_0183 70.57 116.04 69.10 0.60 70.57 47.66 67.76 216354_at AL03166 56.16 96.11 57.29 0.60 56.16 95.15 87.22 214873 at 91355 LRPSL AL13765 16.41 42.77 25.51 0.60 16.41 39.00 13.15 0.34 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 207211_at 9099 USP2 AF07956 6.52 10.00 5.97 0.60 6.52 7.24 9.44 202971_s_at 8445 DYRK2 Y09216 387.05 585.88 349.80 0.60 387.05 623.69 238.02 0.38 217933_s_at 51056 LAPS NM_0159 2126.63 4839.78 2891.17 0.60 2126.63 2787.93 2332.74 213295_at 1540 CYLD AA55509 181.04 590.06 352.62 0.60 181.04 438.26 382.32 202897_at 140885 SIRPA AB02343 702.89 1479.62 884.64 0.60 702.89 1787.89 1917.70 214578_s_at 6093 ROCK1 AV68388 298.04 514.05 307.49 0.60 298.04 313.88 391.02 220874_at NM 0185 25.33 44.84 26.83 0.60 25.33 37.80 16.04 203666_at 6387 CXCL1 NM_0006 34.89 82.37 49.36 0.60 34.89 115.21 169.19 217542_at 1368 CPM BE93051 30.13 51.25 30.72 0.60 30.13 98.01 70.73 0.72 216789_at AK02643 5.94 14.12 8.47 0.60 5.94 23.56 2.65 0.11 217282_at 10905 MAN1 AK00197 34.88 53.83 32.31 0.60 34.88 50.06 36.78 216165_at 84253 GARN AK02565 6.93 12.48 7.49 0.60 6.93 3.79 4.12 208242_at 30062 RAX NM_0134 6.10 15.60 9.37 0.60 6.10 10.96 6.24 0.57 216751_at 284040 CDRT4 AK02487 39.91 69.31 41.61 0.60 39.91 38.04 27.35 212364_at 4430 MYO1 BF43255 29.60 47.70 28.68 0.60 29.60 238.94 298.92 210539_at 23093 TTLLS AK02425 35.15 90.38 54.34 0.60 35.15 63.24 77.27 213488_at 25992 SNED1 N73970 11.35 35.03 21.07 0.60 11.35 28.68 19.39 0.68 201150_s_at 7078 TIMP3 NM_0003 2147.20 3422.85 2058.64 0.60 2147.20 1655.18 3952.57 209160_at 8644 AKR1C AB01858 5.27 16.10 9.68 0.60 5.27 43.53 16.81 0.39 220532_s_at 28959 TMEM NM_0140 438.50 740.35 445.31 0.60 438.50 389.25 397.64 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) AFFX- AFFX- 135.66 286.88 172.71 0.60 135.66 117.60 229.38 HUMRGE/M HUMRG
10098_3_at E/M1009 205637_s_at 6457 SH3GL NM_0030 31.91 63.71 38.36 0.60 31.91 56.14 25.27 0.45 214909_s_at 23564 DDAH AK02619 225.56 347.32 209.48 0.60 225.56 225.55 176.27 203300_x_at 8905 AP1S2 NM_0039 5225.34 9029.88 5446.98 0.60 5225.34 4677.36 5667.04 209392_at 5168 ENPP2 L35594 21.35 77.30 46.63 0.60 21.35 21.59 46.53 219788_at 29992 PILRA NM_0134 21.06 48.36 29.18 0.60 21.06 43.82 56.30 218986_s_at 55601 FLJ200 NM_0176 256.69 451.79 272.81 0.60 256.69 549.85 467.75 213954_at 26049 KIAAO AB02069 18.81 66.78 40.35 0.60 18.81 28.75 79.01 208078sat 150094 SNF1L NM0307 125.45 211.31 127.72 0.60 125.45 497.13 983.86 205333_s_at 9986 RCE1 NM_0051 182.26 299.99 181.34 0.60 182.26 204.63 176.89 221272_s_at 81563 C1orf2l NM_0308 18.45 83.54 50.53 0.60 18.45 100.12 192.92 212813_at 83700 JAMS AA14964 32.85 60.98 36.90 0.61 32.85 39.08 18.84 213148_at 257407 LOC25 AW15689 13.99 33.39 20.20 0.61 13.99 43.98 41.82 205616_at AW13481 9.33 28.11 17.02 0.61 9.33 8.20 16.11 210499_s_at 10084 PQBP1 AB04183 83.01 156.38 94.75 0.61 83.01 93.77 120.50 221496_s_at 10766 TOB2 AL00858 270.75 447.07 270.96 0.61 270.75 307.28 257.74 217359_s_at 4684 NCAM M22094 6.80 29.72 18.02 0.61 6.80 25.25 18.10 0.72 203637_s_at 4281 MID1 NM_0003 24.68 41.22 25.00 0.61 24.68 50.22 23.04 0.46 200887_s_at 6772 STAT1 NM_0073 1429.05 3114.99 1890.80 0.61 1429.05 3209.97 1374.12 0.43 219780 at 51333 ZNF77 NM 0166 8.07 26.89 16.34 0.61 8.07 15.30 20.25 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) AFFX-BioDn- AFFX- 3048.13 4817.97 2928.98 0.61 3048.13 2782.67 1846.70 -at BioDn-5 213075_at 169611 OLFM AL05000 21.79 46.54 28.30 0.61 21.79 35.70 15.66 0.44 216822_x_at AL35976 45.36 80.49 48.94 0.61 45.36 52.86 53.90 160020 at 4323 MMP14 Z48481 547.97 925.24 562.64 0.61 547.97 316.72 464.30 207793sat 2035 EPB41 NM 0044 18.13 44.48 27.06 0.61 18.13 24.54 26.01 207195 at 27255 CNTN6 NM0144 3.92 12.13 7.38 0.61 3.92 3.84 5.70 206450_at 1621 DBH NM_0007 5.26 10.33 6.29 0.61 5.26 4.42 13.50 216837 at 2044 EPHAS L36644 11.84 21.23 12.93 0.61 11.84 24.23 15.12 0.62 204049_s_at 9749 PHACT NM_0147 661.40 1322.14 805.65 0.61 661.40 1798.06 2022.93 220906_at NM_0250 8.92 40.75 24.85 0.61 8.92 21.42 7.53 0.35 208112_x_at 10938 EHD1 NM_0067 292.95 836.69 510.35 0.61 292.95 2309.52 1481.01 0.64 206911_at 7706 TRIM2 NM_0050 198.49 318.97 194.69 0.61 198.49 123.88 319.98 205212_s_at 9744 CENTB NM0147 22.41 37.36 22.82 0.61 22.41 5.03 32.16 214284_s_at 8817 FGF18 AA02294 21.93 34.85 21.29 0.61 21.93 27.34 23.52 217537_x_at M78162 11.51 33.67 20.57 0.61 11.51 20.58 9.53 0.46 214028_x_at 81550 TDRD3 AU15699 38.03 80.42 49.14 0.61 38.03 52.37 52.62 215797_at 348035 MGC40 AE00065 15.84 35.77 21.85 0.61 15.84 28.28 27.43 215852_x_at 140710 C20orfl AK02202 32.52 60.04 36.69 0.61 32.52 39.85 30.73 58780_s_at 55701 FLJ103 R42449 502.95 777.06 475.08 0.61 502.95 1286.29 474.40 0.37 221392_at 50832 TAS2R NM_0169 17.85 32.03 19.59 0.61 17.85 27.80 13.99 0.50 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 220090_at 49860 CRNN NM_0161 9.55 14.94 9.14 0.61 9.55 7.34 11.96 204096_s_at 8178 ELL AL13677 61.79 97.89 59.90 0.61 61.79 67.93 78.75 219622_at 55647 RAB20 NM_0178 280.66 533.00 326.50 0.61 280.66 353.58 426.69 206965_at 11278 KLF12 NM_0162 7.50 35.23 21.59 0.61 7.50 15.40 9.19 0.60 220364_at 54508 FLJ112 NM 0190 11.10 24.76 15.17 0.61 11.10 6.53 13.74 206487_at 23353 UNC84 NM_0251 8.09 20.07 12.30 0.61 8.09 3.65 13.03 220524_at 54566 EPB41 NM_0248 3.99 10.81 6.62 0.61 3.99 8.00 5.31 202273_at 5159 PDGFR NM_0026 27.54 49.04 30.07 0.61 27.54 15.71 7.50 210424_s_at 23015 // GOLG AF16462 165.95 281.58 172.67 0.61 165.95 159.59 199.51 GOLG

211402_x_at 2649 NR6A1 AF00429 6.85 34.80 21.35 0.61 6.85 53.15 41.38 222054_at 664727 LOC66 BF51155 61.57 110.25 67.66 0.61 61.57 96.20 125.55 215437xat 11176 BAZ2A BE51365 37.23 79.45 48.76 0.61 37.23 42.10 44.56 217691_x_at 9123 SLC16 AA85317 259.50 496.83 305.07 0.61 259.50 453.55 460.67 221887_s_at 25861 DFNB3 BE04599 8.92 49.81 30.60 0.61 8.92 39.37 57.36 211799 x at 3107 HLA-C U62824 1250.72 2051.02 1260.54 0.61 1250.72 1070.82 1619.81 213924_at 65258 MPPE1 BF47650 6.82 14.22 8.74 0.61 6.82 11.07 24.41 204891_s_at 3932 LCK NM_0053 5.63 10.98 6.75 0.62 5.63 6.94 4.22 202895_s_at 140885 SIRPA D86043 110.67 206.40 127.01 0.62 110.67 105.38 191.50 211681_s_at 10611 PDLIM AF11670 153.09 237.78 146.52 0.62 153.09 128.69 205.71 204770_at 6891 TAP2 NM_0005 74.12 118.40 72.99 0.62 74.12 61.99 47.33 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 211139_s_at 4664 NAB1 AF04545 264.84 633.15 390.50 0.62 264.84 431.83 772.97 215874_at 6482 ST3GA AK02682 45.38 108.71 67.05 0.62 45.38 57.62 47.46 210109_at 27099 NAG8 AF19149 97.09 229.39 141.67 0.62 97.09 167.40 199.58 209935_at 27032 ATP2C AF22598 97.38 166.37 102.77 0.62 97.38 496.95 571.50 207497_s_at 2206 MS4A2 D10583 4.70 38.40 23.72 0.62 4.70 33.23 9.25 0.28 211259_s_at 655 BMP7 BC00424 9.88 27.92 17.25 0.62 9.88 21.05 27.41 206763_at 8468 FKBP6 NM_0036 16.91 26.85 16.59 0.62 16.91 31.50 18.80 0.60 201148_s_at 7078 TIMP3 AW33893 699.60 1285.56 794.53 0.62 699.60 758.77 2063.65 219353_at 374354 NHLR NM_0176 96.42 168.98 104.44 0.62 96.42 172.95 74.99 0.43 AFFX-r2-Ec- AFFX-r2- 674.50 1038.38 641.82 0.62 674.50 635.36 415.27 bioB-3 at Ec-bioB -3 210564_x_at 8837 CFLAR AF00961 220.24 702.70 434.38 0.62 220.24 729.67 1093.87 205878_at 5463 POU6F NM 0027 4.24 44.00 27.21 0.62 4.24 44.54 14.65 0.33 210359_at 9788 MTSS1 AF11667 21.07 46.89 29.00 0.62 21.07 52.63 102.29 220180_at 80323 CCDC6 NM_0252 6.00 35.74 22.10 0.62 6.00 90.64 116.81 214971_s_at 6480 ST6GA AV69571 37.97 81.03 50.12 0.62 37.97 22.60 86.03 203233_at 3566 IL4R NM_0004 279.19 505.68 312.95 0.62 279.19 842.42 452.06 0.54 205473_at 525 ATP6V NM_0016 29.82 46.35 28.69 0.62 29.82 41.51 11.88 210461_s_at 3983 ABLIM BC00244 9.24 30.29 18.75 0.62 9.24 18.80 22.94 215121_x_at 28786 // IGL@ AA68030 50.69 83.03 51.46 0.62 50.69 61.94 46.91 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 212201_at 23141 KIAAO AW27487 463.04 714.47 443.48 0.62 463.04 913.05 1097.30 216793_x_at AK02685 12.86 21.40 13.28 0.62 12.86 8.43 23.38 210925_at 4261 CIITA U18288 18.82 59.46 36.91 0.62 18.82 42.50 30.85 0.73 220229sat 23431 AP4E1 AB03065 24.81 54.42 33.79 0.62 24.81 23.25 38.14 206118_at 6775 STAT4 NM_0031 84.34 383.05 238.05 0.62 84.34 5306.00 3824.38 0.72 221028_s_at 81577 GFOD2 NM_0308 79.24 122.03 75.85 0.62 79.24 100.55 74.12 202865_at 54788 DNAJB A1695173 47.05 73.85 45.91 0.62 47.05 70.06 72.33 205947_s_at 7434 VIPR2 NM_0033 6.25 28.43 17.68 0.62 6.25 17.85 23.55 207976_at 23276 KLHL1 NM_0250 11.95 62.85 39.10 0.62 11.95 36.86 14.11 0.38 202734_at 9322 TRIP10 NM_0042 188.84 413.86 257.63 0.62 188.84 1185.35 1386.27 209084_s_at 9364 RAB28 BE50468 204.05 475.92 296.32 0.62 204.05 172.88 340.37 207379_at 10085 EDIL3 NM_0057 25.90 47.37 29.50 0.62 25.90 11.98 20.84 208520_at 26532 OR10H NM_0139 13.74 31.43 19.57 0.62 13.74 9.25 23.60 219672 at 51327 ERAF NM 0166 13.47 21.30 13.27 0.62 13.47 47.87 24.96 0.52 222142_at 1540 CYLD AK02421 8.90 28.42 17.71 0.62 8.90 30.39 15.98 0.53 AFFX-r2-Ec- AFFX-r2- 6369.45 9725.48 6063.32 0.62 6369.45 5914.31 4171.27 bioD-5_at Ec-bioD-203299sat 653653 AP1S2 AF25129 1151.83 1852.40 1155.30 0.62 1151.83 1843.22 1410.88 213135_at 7074 TIAM1 U90902 6.65 10.46 6.53 0.62 6.65 25.05 5.00 0.20 215029_at AL11745 136.94 264.93 165.28 0.62 136.94 137.77 195.80 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 216368_s_at 1285 COL4A U02520 18.57 39.49 24.65 0.62 18.57 21.42 21.89 215006_at 2146 EZH2 AK02381 161.19 356.14 222.37 0.62 161.19 294.09 224.74 204858_s_at 1890 ECGF1 NM_0019 164.15 328.49 205.11 0.62 164.15 220.27 145.54 35150_at 958 CD40 X60592 367.39 1633.92 1020.81 0.62 367.39 2347.53 2383.94 217556_at W26966 15.92 35.28 22.05 0.62 15.92 12.87 7.59 219011_at 57664 PLEKH NM_0209 5.33 12.80 8.00 0.63 5.33 10.41 3.98 0.38 206608_s_at 57096 RPGRI NM_0203 19.76 58.99 36.88 0.63 19.76 34.04 60.21 211619_s_at 250 /// ALPP M13077 11.13 21.72 13.58 0.63 11.13 17.16 26.41 ALPPL

221397_at 50839 TAS2R NM_0239 15.51 33.66 21.06 0.63 15.51 20.38 3.36 204881_s_at 7357 UGCG NM_0033 577.92 1184.67 741.69 0.63 577.92 2246.79 1180.95 0.53 205023_at 5888 RAD51 D14134 77.01 115.82 72.58 0.63 77.01 84.63 52.56 208365_s_at 2868 GRK4 NM_0053 8.06 21.42 13.43 0.63 8.06 29.13 31.82 220389_at 60494 CCDC8 NM_0218 7.68 42.33 26.54 0.63 7.68 26.54 28.73 201789_at 51635 DHRS7 BC00063 1.18 19.32 12.12 0.63 1.18 12.37 9.44 208919_s_at 65220 NADK BO00170 900.45 1413.99 886.93 0.63 900.45 924.31 516.42 212583_at 9716 AQR ABO1113 101.92 153.15 96.07 0.63 101.92 124.34 99.96 201203_s_at 6238 RRBP1 NM_0045 68.61 127.48 80.08 0.63 68.61 44.36 76.03 221466_at 5030 P2RY4 NM_0025 33.22 52.02 32.69 0.63 33.22 47.60 21.74 AFFX-r2-Ec- AFFX-r2- 7130.20 11037.18 6938.94 0.63 7130.20 7113.06 4857.27 bioD-3_at Ec-bioD-213825 at 10215 OLIG2 AA75741 177.42 397.25 250.20 0.63 177.42 647.08 471.46 0.73 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 213247_at 79987 SVEP1 AA71610 19.38 35.31 22.27 0.63 19.38 27.66 19.37 219046_s_at 63876 PKNO NM_0220 12.30 25.09 15.83 0.63 12.30 29.64 12.87 0.43 205847_at 64063 PRSS22 NM_0221 77.26 124.77 78.79 0.63 77.26 84.60 19.03 206828_at 7294 TXK NM_0033 58.25 93.71 59.24 0.63 58.25 88.35 70.68 211222_s_at 9001 HAP1 AF04072 19.73 37.72 23.85 0.63 19.73 28.98 8.75 201124_at 3693 ITGB5 AL04842 28.88 45.90 29.02 0.63 28.88 19.91 11.77 221447_s_at 83468 GLT8D NM_0313 6.94 10.87 6.87 0.63 6.94 20.95 30.40 212404sat 89910 UBE3B AL09674 127.44 252.10 159.49 0.63 127.44 82.31 117.26 210748_at AF11669 19.49 39.78 25.17 0.63 19.49 50.46 7.42 0.15 210735_s_at 771 CA12 BC00027 37.66 57.90 36.65 0.63 37.66 25.17 40.37 204685_s_at 491 ATP2B R52647 17.49 33.62 21.29 0.63 17.49 33.78 15.47 0.46 201251_at 5315 PKM2 NM_0026 4116.97 6968.84 4411.92 0.63 4116.97 8731.66 7064.40 204844 at 2028 ENPEP L12468 7.27 19.46 12.34 0.63 7.27 7.10 6.45 219442_at 79014 C16orf6 NM_0240 130.89 342.36 217.13 0.63 130.89 216.35 88.77 0.41 208544_at 151 ADRA2 NM_0006 10.78 28.32 17.97 0.63 10.78 22.18 29.97 210754sat 4067 LYN M79321 1603.33 2731.93 1735.29 0.64 1603.33 4974.01 7894.67 217209_at X16454 33.99 52.11 33.13 0.64 33.99 30.09 37.82 220867_s_at 25769 SLC24 NM_0203 12.47 29.90 19.03 0.64 12.47 20.15 22.04 204101_at 4534 MTM1 NM_0002 29.95 84.37 53.71 0.64 29.95 52.62 63.75 207516_at 1143 CHRN NM_0007 7.30 32.53 20.71 0.64 7.30 19.23 23.79 221086s at 55079 FEZF2 NM 0180 2.39 11.54 7.35 0.64 2.39 6.01 6.06 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 212294_at 55970 GNG12 BG11176 49.62 100.69 64.17 0.64 49.62 199.96 85.64 0.43 212707_s_at 10156 // RASA4 A1738591 167.72 381.62 243.36 0.64 167.72 354.83 261.21 0.74 221412 at 57191 VN1R1 NM0206 44.07 84.16 53.67 0.64 44.07 23.25 25.14 210669_at 7020 TFAP2 M61156 15.56 27.33 17.43 0.64 15.56 37.30 28.93 A

201015_s_at 3728 JUP NM 0219 70.44 168.05 107.21 0.64 70.44 57.99 43.14 208438_s_at 2268 FGR NM_0052 345.06 645.11 411.87 0.64 345.06 1087.42 708.01 0.65 215377_at 1488 CTBP2 AK02412 25.33 58.74 37.50 0.64 25.33 30.86 35.84 215825_at AF07057 39.51 80.54 51.45 0.64 39.51 51.44 49.85 220732_at 80243 DEPDC NM_0251 15.45 29.50 18.85 0.64 15.45 13.48 23.18 212365_at 4430 MYO1 BF21599 76.00 116.31 74.35 0.64 76.00 428.19 521.05 213143_at 257407 LOC25 BE85670 10.40 42.99 27.49 0.64 10.40 17.10 49.55 207329_at 4317 MMP8 NM_0024 7.50 14.80 9.46 0.64 7.50 22.29 22.05 34187_at 5939 RBMS2 D28483 26.05 66.50 42.54 0.64 26.05 66.53 78.57 203902_at 9843 HEPH AU14822 6.49 16.97 10.86 0.64 6.49 4.22 5.90 206004_at 7053 TGM3 NM_0032 20.39 53.13 34.04 0.64 20.39 43.49 36.15 218292_s_at 51422 PRKA AF08787 193.43 294.73 188.90 0.64 193.43 189.82 330.38 216112_at 5586 PKN2 AU15720 121.57 194.69 124.82 0.64 121.57 121.46 87.33 203961_at 10529 NEBL AL15739 46.52 87.50 56.10 0.64 46.52 84.83 44.14 0.52 202430_s_at 5359 PLSCR NM_0211 273.08 513.90 329.56 0.64 273.08 845.17 326.33 0.39 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 216004_s_at 5316 PKNO AP00174 31.67 59.63 38.26 0.64 31.67 24.52 48.07 212617_at 23060 ZNF60 AB00229 33.73 83.85 53.80 0.64 33.73 74.90 57.01 206283_s_at 6886 TALI NM_0031 21.49 34.84 22.36 0.64 21.49 30.31 32.34 220407_s_at 7042 TGFB2 NM_0032 5.47 37.06 23.80 0.64 5.47 9.87 7.58 209156_s_at 1292 COL6A AY02920 217.33 433.74 278.89 0.64 217.33 1081.05 796.10 0.74 205518_s_at 8418 CMAH NM_0035 22.59 38.51 24.78 0.64 22.59 7.27 19.58 205870_at 624 BDKR NM_0006 19.92 40.48 26.06 0.64 19.92 86.27 116.82 203399_x_at 5671 PSG3 NM_0210 7.60 17.11 11.02 0.64 7.60 2.11 7.82 219647_at 64091 POPDC NM_0221 22.61 52.03 33.52 0.64 22.61 47.62 69.30 215805_at BF57466 9.76 29.21 18.83 0.64 9.76 4.86 10.20 215713_at 9839 ZFHX1 AK02677 4.56 38.66 24.93 0.64 4.56 26.10 14.02 0.54 212660_at 23338 P11F15 A1735639 576.96 1009.94 651.54 0.65 576.96 2432.97 977.41 0.40 220977_x_at 57669 EPB41 NM_0209 36.16 67.69 43.67 0.65 36.16 43.84 27.97 215462_at 1263 PLK3 A1978990 72.42 120.29 77.62 0.65 72.42 126.22 142.78 221901_at 85352 KIAA1 BF51607 89.67 184.24 119.00 0.65 89.67 139.05 142.26 216531_at 404281 YY2 U73479 56.91 95.22 61.53 0.65 56.91 83.46 42.28 209304_x_at 4616 GADD AF08785 272.11 534.74 345.60 0.65 272.11 703.61 1002.36 217322_x_at AL02450 80.30 180.68 116.85 0.65 80.30 85.42 125.58 210029_at 3620 INDO M34455 19.57 45.50 29.43 0.65 19.57 149.19 74.08 0.50 207820_at 124 ADH1 NM_0006 4.69 19.47 12.60 0.65 4.69 20.26 10.12 0.50 215761_at 23312 DMXL AK00015 57.79 174.51 112.94 0.65 57.79 111.22 108.10 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 32088_at 8548 BLZF1 U79751 78.47 129.18 83.62 0.65 78.47 169.25 98.06 0.58 214272_at 1540 CYLD A1362018 9.15 81.94 53.05 0.65 9.15 21.09 53.43 221695_s_at 10746 MAPS AF23979 204.53 349.71 226.49 0.65 204.53 205.21 279.05 205896_at 6583 SLC22 NM_0030 102.96 162.72 105.48 0.65 102.96 147.16 219.11 217237_at 23090 ZNF42 Y10615 7.58 15.55 10.08 0.65 7.58 6.09 5.46 215755_at 51149 LOC51 AK02200 28.89 47.14 30.58 0.65 28.89 34.06 36.84 210193_at 4336 MOBP D28114 13.75 29.91 19.41 0.65 13.75 27.28 19.52 0.72 220586_at 80205 CHD9 NM_0251 34.86 90.77 58.91 0.65 34.86 45.65 37.24 215511_at 6942 TCF20 U19345 40.77 68.61 44.55 0.65 40.77 61.34 40.04 0.65 206910_x_at 3080 CFHR2 NM_0056 21.31 51.41 33.39 0.65 21.31 55.07 38.04 0.69 216474xat 7177 TPSAB AF20666 46.42 103.87 67.49 0.65 46.42 47.42 85.79 220826_at 55264 C2lorf7 NM_0182 23.39 40.19 26.12 0.65 23.39 30.92 28.53 212655_at 23174 ZCCHC AB01115 541.29 811.99 527.88 0.65 541.29 720.52 826.97 207851_s_at 3643 INSR NM_0002 5.86 18.96 12.33 0.65 5.86 24.04 11.25 0.47 219593_at 51296 SLC15 NM_0165 128.93 261.56 170.14 0.65 128.93 216.13 125.41 0.58 205727_at 7011 TEP1 NM_0071 87.10 154.59 100.57 0.65 87.10 32.07 39.01 206036_s_at 5966 REL NM_0029 288.39 572.98 373.04 0.65 288.39 3020.79 3918.11 216888_at 11155 LDB3 AJ133768 4.21 15.48 10.08 0.65 4.21 29.68 19.46 0.66 216373_at 202018 FLJ900 AF18925 31.94 49.50 32.24 0.65 31.94 41.00 28.04 214972_at 10724 MGEA AU14479 50.75 92.11 60.03 0.65 50.75 41.31 51.48 222284_at 23094 SIPAIL A17341 11 27.78 95.64 62.35 0.65 27.78 45.75 38.47 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 214357_at 92346 ClorflO AL03529 9.21 39.89 26.05 0.65 9.21 43.65 41.23 222281_s_at AW51771 6.67 39.48 25.78 0.65 6.67 45.09 4.33 0.10 207009_at 8929 PHOX2 NM_0039 11.20 34.54 22.56 0.65 11.20 30.64 3.63 0.12 207752_x_at 5542 /// PRB 1 NM_0050 13.83 28.05 18.32 0.65 13.83 28.25 10.97 0.39 214066_x_at 4882 NPR2 AA56571 24.25 36.88 24.10 0.65 24.25 30.60 22.81 203320_at 10019 SH2B3 NM_0054 708.53 2437.96 1593.10 0.65 708.53 3672.37 2311.01 0.63 217702_at 9466 IL27RA AW29506 5.75 10.47 6.85 0.65 5.75 5.86 11.24 215637_at 95681 TSGA1 AU15562 12.04 25.20 16.48 0.65 12.04 5.22 9.44 207062_at 3375 LAPP NM_0004 7.22 28.80 18.84 0.65 7.22 23.04 13.54 0.59 214844_s_at 55816 DOK5 AL05006 12.45 28.42 18.59 0.65 12.45 35.85 15.47 0.43 217019_at AL13716 64.66 129.60 84.81 0.65 64.66 49.61 77.68 AFFX-r2-Ec- AFFX-r2- 764.61 1149.20 752.18 0.65 764.61 752.17 499.17 bioB-5 at Ec-bioB -5 220931_at 79024 MGC55 NM_0240 15.69 39.04 25.56 0.65 15.69 19.40 22.77 204727_at 11169 WDHD AW77214 40.69 71.36 46.75 0.66 40.69 57.06 52.92 216679_at AL13762 9.42 18.12 11.88 0.66 9.42 23.07 19.74 220909_at 80128 TRIM4 NM_0250 35.35 54.50 35.76 0.66 35.35 3.32 3.51 206169_x_at 23264 ZC3H7 NM_0250 115.23 248.26 163.09 0.66 115.23 148.70 109.75 212124_at 57178 ZMIZ1 AF07062 681.19 1160.43 762.78 0.66 681.19 2326.64 1756.20 209636_at 4791 NFKB2 BC00284 34.99 322.88 212.26 0.66 34.99 617.38 671.08 202626 s at 4067 LYN A1356412 1438.88 2329.78 1531.95 0.66 1438.88 5562.31 7279.54 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 201529_s_at 6117 RPA1 NM_0029 565.07 906.18 595.97 0.66 565.07 370.61 443.33 207056_s_at 9498 SLC4A NM_0048 11.63 30.36 19.98 0.66 11.63 19.99 14.94 0.75 218815_s_at 55092 TMEM NM_0180 263.16 447.68 294.72 0.66 263.16 363.55 428.74 220310_at 79861 TUBAL NM_0248 7.45 28.67 18.88 0.66 7.45 11.66 2.19 0.19 AFFX-r2-P1- AFFX-r2- 17179.16 26443.23 17413.63 0.66 17179.16 15993.52 12055.6 cre-5 at P1-cre-5 8 216437_at 80314 EPC1 AK02494 6.46 31.89 21.01 0.66 6.46 23.12 20.84 202504_at 23650 TRIM2 NM_0121 15.56 35.32 23.26 0.66 15.56 13.39 20.47 217509_x_at 2901 GRIKS BG15152 46.33 121.35 79.94 0.66 46.33 67.38 76.62 203927_at 4794 NFKBI NM0045 382.24 2087.41 1375.43 0.66 382.24 2383.78 1855.26 AFFX-CreX- AFFX- 14271.66 21688.15 14293.15 0.66 14271.66 13842.55 9433.75 5 -at CreX-5 220269_at 79740 FLJ230 NM_0246 2.30 20.39 13.45 0.66 2.30 78.87 63.00 221875 x at 3134 HLA-F AW51421 1488.70 2288.67 1509.87 0.66 1488.70 1369.52 1841.85 218835 at 6436 /// SFTPA NM 0069 24.85 41.58 27.43 0.66 24.85 11.62 35.79 205465_x_at 9957 HS3ST BF00029 6.96 11.78 7.78 0.66 6.96 7.72 7.20 215531_s_at 2558 /// GABR BF96618 9.23 19.41 12.81 0.66 9.23 7.65 7.03 201884_at 1048 CEAC NM_0043 9.75 39.13 25.85 0.66 9.75 32.73 25.97 201108_s_at 7057 THBS1 NM_0032 13.53 78.51 51.89 0.66 13.53 286.55 163.79 0.57 204790_at 4092 SMAD NM_0059 163.77 490.09 323.93 0.66 163.77 450.51 673.61 215536 at 3120 HLA- X87344 12.47 40.20 26.60 0.66 12.47 25.79 44.07 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 212200_at 23141 KIAAO AW27487 305.95 515.18 340.98 0.66 305.95 770.21 724.43 200777_s_at 151579 BZW1 NM_0146 2959.96 4701.01 3113.34 0.66 2959.96 5836.96 5351.54 216638_s_at 5618/// PRLR S78505 17.20 28.84 19.10 0.66 17.20 23.11 6.20 201502_s_at 4792 NFKBI NM_0205 1349.53 15293.14 10129.70 0.66 1349.53 10601.20 11863.6 215529_x_at 23181 DIP2A A1590053 298.88 563.23 373.18 0.66 298.88 449.03 401.69 210623_at 51035 LOC51 BC00137 41.58 77.67 51.47 0.66 41.58 53.36 64.66 217662_x_at 55973 BCAP2 A1393960 59.25 148.94 98.72 0.66 59.25 178.48 83.81 0.47 215156_at 80349 WDR61 AL10970 69.90 119.82 79.49 0.66 69.90 68.35 110.86 212658_at 10184 LHFPL N66633 124.37 207.60 137.75 0.66 124.37 142.95 178.91 221181_at 642452 LOC64 NM_0250 8.40 12.78 8.48 0.66 8.40 5.53 6.84 205802_at 7220 TRPC1 NM_0033 5.78 15.55 10.32 0.66 5.78 11.44 32.69 211122_s_at 6373 CXCL1 AF00298 3.85 345.79 229.58 0.66 3.85 238.41 69.88 0.29 205964 at 79088 ZNF42 NM0241 111.74 170.09 112.94 0.66 111.74 120.12 151.55 216512_s_at 1638 DCT AL13931 14.23 40.62 26.98 0.66 14.23 17.37 20.91 210151_s_at 8444 DYRK3 AF18677 8.17 28.18 18.73 0.66 8.17 62.20 29.79 0.48 206322 at 8224 SYN3 NM 0034 24.27 38.25 25.44 0.66 24.27 7.80 8.83 217628_at 53405 CLICS BF03280 8.09 22.63 15.05 0.66 8.09 35.52 35.14 216250 s at 9404 LPXN X77598 383.36 687.48 457.32 0.67 383.36 3109.00 837.35 0.27 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 206306_at 6263 RYR3 NM_0010 7.70 16.97 11.29 0.67 7.70 11.05 9.63 211883_x_at 634 CEAC M76742 59.09 94.50 62.87 0.67 59.09 60.15 78.24 AFFX- AFFX- 404.65 737.51 490.80 0.67 404.65 658.49 737.56 M27830_5_at M27830_ 201786_s_at 103 ADAR NM_0011 4417.18 7250.24 4827.70 0.67 4417.18 6909.82 3641.86 0.53 220599_s_at 79092 CARD1 NM_0241 28.08 49.68 33.08 0.67 28.08 39.54 11.72 208221_s_at 6585 SLIT1 NM_0030 18.40 32.96 21.97 0.67 18.40 4.63 18.65 219615_s_at 8645 KCNK5 NM 0037 135.71 205.14 136.73 0.67 135.71 450.17 409.57 204793_at 9737 GPRAS NM_0147 49.09 74.57 49.72 0.67 49.09 69.12 44.06 210001_s_at 8651 SOCS1 AB00504 46.09 79.23 52.85 0.67 46.09 66.05 49.38 210403_s_at 3758 KCNJ1 U03884 3.22 17.46 11.65 0.67 3.22 13.88 8.36 0.60 205221_at 3081 HGD NM_0001 16.25 81.03 54.08 0.67 16.25 288.86 209.61 0.73 205954_at 6258 RXRG NM_0069 6.40 26.99 18.02 0.67 6.40 4.34 4.95 221153_s_at NM_0203 15.01 22.98 15.35 0.67 15.01 3.04 16.28 216277_at 699 BUB1 AK02354 35.36 54.42 36.35 0.67 35.36 40.78 27.75 220691_at 259230 TMEM NM_0141 57.55 88.51 59.13 0.67 57.55 58.22 55.49 208288_at 8647 ABCB1 NM_0037 6.70 15.07 10.08 0.67 6.70 0.99 1.87 211459_at AF23426 18.55 47.38 31.68 0.67 18.55 28.50 22.51 212736_at 89927 C16orf4 BE29945 42.03 69.82 46.68 0.67 42.03 64.33 39.84 0.62 207115xat 54799 MBTD NM0176 115.01 215.85 144.37 0.67 115.01 104.26 121.70 213870_at 1302 COL11 AL03122 26.53 41.65 27.87 0.67 26.53 43.95 49.04 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 53720_at 55337 FLJ112 A1862559 274.92 414.86 278.08 0.67 274.92 374.88 143.18 212463_at 966 CD59 BE37900 31.03 110.17 73.88 0.67 31.03 127.77 111.22 211887_x_at 4481 MSR1 AF03735 3.67 16.64 11.16 0.67 3.67 9.83 3.29 221071_at NM_0216 58.63 107.90 72.42 0.67 58.63 88.54 68.52 211964_at 1284 COL4A X05610 127.61 295.89 198.62 0.67 127.61 722.90 294.05 0.41 217077_s_at 9568 GARB AF09572 16.77 54.73 36.74 0.67 16.77 6.92 23.36 204105_s_at 4897 NRCA NM_0050 5.87 86.82 58.30 0.67 5.87 509.88 780.69 222341_x_at 64770 CCDC1 AW97323 32.80 67.63 45.42 0.67 32.80 26.35 22.53 215504_x_at 55608 ANKR AF13177 253.88 462.49 310.69 0.67 253.88 417.14 261.90 0.63 222207_x_at 441258 LOC44 AK02460 366.92 831.22 558.40 0.67 366.92 413.34 477.86 209508_x_at 8837 CFLAR AF00577 308.24 873.96 587.65 0.67 308.24 1200.33 1459.02 207973_x_at 56 ACRV1 NM_0201 32.88 66.09 44.47 0.67 32.88 45.71 35.70 209655_s_at 83604 TMEM AL13655 23.21 43.76 29.44 0.67 23.21 32.91 80.18 209994sat 5243 /// ABCB1 AF01653 145.68 251.85 169.48 0.67 145.68 132.14 178.21 213389_at 9640 ZNF59 BF50861 147.72 234.99 158.13 0.67 147.72 216.83 162.18 206812_at 155 ADRB3 NM_0000 15.09 34.26 23.08 0.67 15.09 4.60 15.91 206673_at 11245 GPR17 NM_0072 9.50 49.00 33.03 0.67 9.50 17.19 10.05 0.58 205676_at 1594 CYP27 NM_0007 76.64 128.14 86.37 0.67 76.64 406.20 296.39 0.73 202597_at 3664 IRF6 AU14428 30.92 66.00 44.51 0.67 30.92 47.75 16.65 0.35 219334 s at 64859 OBFC2 AU15754 11.78 40.74 27.48 0.67 11.78 425.71 373.06 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 220458_at 55104 FLJ102 NM_0180 90.06 143.96 97.27 0.68 90.06 62.89 93.47 201005_at 928 CD9 NM_0017 235.01 367.10 248.04 0.68 235.01 208.11 245.69 219730_at 54797 MED18 NM_0176 54.32 120.86 81.69 0.68 54.32 47.50 51.91 220943_s_at 55471 PRO18 NM_0186 55.91 89.90 60.78 0.68 55.91 80.23 56.71 202724_s_at 2308 FOXO1 NM_0020 56.81 96.81 65.46 0.68 56.81 222.43 81.28 0.37 204715_at 24145 PANX1 NM 0153 357.33 551.48 373.20 0.68 357.33 661.21 936.84 214851_at 3172 HNF4A X87870 14.90 32.65 22.10 0.68 14.90 14.21 37.81 219847_at 79885 HDAC1 NM_0248 45.72 106.67 72.23 0.68 45.72 54.92 27.70 208811_s_at 10049 DNAJB AF08056 707.33 1076.06 728.62 0.68 707.33 582.11 1436.08 220841_s_at 54806 AHI1 NM_0176 62.67 138.62 93.87 0.68 62.67 93.44 82.63 214964 at 84629 KIAA1 AA55443 275.73 463.31 313.77 0.68 275.73 179.13 143.34 217382_at 390363 LOC39 U85978 12.97 49.25 33.36 0.68 12.97 36.11 6.55 0.18 214392_at 56269 IRGC AA43198 16.75 35.66 24.17 0.68 16.75 3.69 6.71 214888_at 824 CAPN2 AK02385 108.56 176.72 119.82 0.68 108.56 178.68 171.90 211766_s_at 5408 PNLIP BC00598 5.67 17.43 11.82 0.68 5.67 9.67 7.10 214091sat 2878 GPX3 AW14984 19.74 55.27 37.49 0.68 19.74 40.85 52.40 206744sat 9205 ZMYM NM0142 31.48 50.75 34.43 0.68 31.48 46.77 39.03 216053xat 731501 LOC73 A1143919 7.46 36.01 24.44 0.68 7.46 15.55 17.15 39582_at 1540 CYLD AL05016 99.81 306.63 208.15 0.68 99.81 254.18 235.07 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 203395_s_at 3280 HES1 NM 0055 18.30 52.79 35.84 0.68 18.30 60.77 81.60 200880 at 3301 DNAJA AL53410 2771.33 4157.01 2823.89 0.68 2771.33 3513.12 4162.73 211484_s_at 1826 DSCA AF02345 11.59 19.76 13.43 0.68 11.59 22.61 14.12 0.62 217497_at 1890 ECGF1 AW61338 141.27 597.75 406.19 0.68 141.27 528.61 247.50 0.47 217436_x_at 730399 LOC73 M80469 1133.05 1809.86 1230.34 0.68 1133.05 1080.95 1477.65 210286_s_at 9497 SLC4A AF05375 30.70 58.08 39.48 0.68 30.70 28.82 47.62 218345_at 55365 TMEM NM_0184 52.95 119.25 81.15 0.68 52.95 44.91 53.65 221556_at 8555 CDC14 BF79263 227.90 355.10 241.72 0.68 227.90 141.47 178.16 205933_at 26040 SETBP NM_0155 29.98 47.57 32.39 0.68 29.98 76.14 61.58 212817_at 25822 DNAJB AK02325 42.19 92.38 62.92 0.68 42.19 171.62 254.15 215135_at 23549 DNPEP A1690583 22.67 47.55 32.39 0.68 22.67 55.90 41.32 0.74 207882_at 55566 HSAJ2 NM_0175 15.72 34.81 23.71 0.68 15.72 31.86 15.80 0.50 207031_at 579 BAPX1 NM_0011 279.73 425.74 290.04 0.68 279.73 234.35 119.73 216746_at AK02460 13.21 33.88 23.08 0.68 13.21 17.89 11.68 214818_at 284001 CCDCS AF00714 11.76 66.59 45.39 0.68 11.76 139.35 76.55 0.55 213748_at 9866 TRIM6 AW27171 81.36 139.78 95.35 0.68 81.36 67.68 71.22 205003_at 9732 DOCK4 NM_0147 22.06 72.34 49.35 0.68 22.06 175.01 94.98 0.54 205925_s_at 5865 RAB3B NM_0028 5.37 29.30 19.99 0.68 5.37 12.94 21.66 220792_at 11107 PRDMS NM_0186 34.77 59.18 40.40 0.68 34.77 29.53 29.85 210077s at 6430 SFRSS U30884 93.50 169.73 116.02 0.68 93.50 80.57 178.43 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 217639_at BF67474 12.20 27.20 18.59 0.68 12.20 31.32 16.76 0.54 222074_at 4088 /// SMAD AW61443 30.64 55.55 37.98 0.68 30.64 42.99 36.35 UROD
215777 at AW40597 7.08 18.26 12.48 0.68 7.08 21.42 19.79 215849_x_at 118491 TTC18 AK02223 56.56 113.07 77.37 0.68 56.56 55.85 71.80 207555_s_at 6915 TBXA2 U27325 27.10 70.10 47.99 0.68 27.10 15.67 30.22 R

202132_at 25937 WWTR AA08108 25.28 68.69 47.02 0.68 25.28 37.60 15.29 221212_x_at 55193 PB1 NM_0183 7.87 20.15 13.80 0.68 7.87 6.13 23.64 220580_at 80114 BICC1 NM_0250 14.04 38.40 26.31 0.69 14.04 34.35 19.74 0.57 201169_s_at 8553 BHLH BG32604 51.47 195.62 134.05 0.69 51.47 113.56 529.80 208849_at AF11809 18.84 35.27 24.19 0.69 18.84 25.63 25.23 220221_at 55187 VPS13 NM_0181 26.24 91.20 62.57 0.69 26.24 40.97 52.36 213620_s_at 3384 ICAM2 AA12672 156.89 254.36 174.67 0.69 156.89 105.03 106.01 204760_s_at 7067 /// THRA NM_0217 25.60 57.52 39.51 0.69 25.60 5.62 20.69 220546_at 79951 FLJ117 NM_0248 29.44 50.10 34.42 0.69 29.44 23.99 33.02 216765_at 5607 MAP2 AK02517 42.07 85.02 58.42 0.69 42.07 28.79 7.33 215066_at 5792 PTPRF AU15844 51.32 86.06 59.18 0.69 51.32 77.06 38.82 0.50 214405_at 10659 CUGBP Z39557 32.89 50.92 35.04 0.69 32.89 40.18 3.17 219275_at 9141 PDCDS NM_0047 385.85 629.08 433.98 0.69 385.85 298.47 396.25 39548_at 4862 NPAS2 U77970 13.34 35.64 24.59 0.69 13.34 45.56 26.10 0.57 211135 x at 10288 // LILRB AF00964 91.64 151.04 104.25 0.69 91.64 164.72 36.60 0.22 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) LILRB

216347_s_at 23368 PPP1R1 AK02318 65.18 124.91 86.23 0.69 65.18 119.13 129.16 202181_at 9766 KIAAO NM0147 735.40 1507.19 1041.22 0.69 735.40 1731.91 2576.81 207930_at 3933 LCN1 NM0022 14.44 24.72 17.09 0.69 14.44 9.34 17.46 209458_x_at 3039 /// HBA1 AF10597 11.10 17.92 12.40 0.69 11.10 17.81 15.91 204975_at 2013 EMP2 NM_0014 232.08 355.93 246.35 0.69 232.08 517.43 296.99 0.57 206107_at 8786 RGS11 NM_0038 4.01 11.10 7.68 0.69 4.01 1.75 4.99 214212_x_at 10979 PLEKH A1928241 19.85 52.50 36.36 0.69 19.85 30.61 45.65 203548_s_at 4023 LPL BF67297 461.02 988.96 685.13 0.69 461.02 4167.52 3450.99 215898_at 23093 TTLLS AK02187 56.91 120.39 83.42 0.69 56.91 91.67 88.85 204679_at 3775 KCNK1 NM_0022 8.73 27.27 18.90 0.69 8.73 26.87 15.82 0.59 209967_s_at 1390 CREM D14826 30.25 79.64 55.21 0.69 30.25 253.82 111.36 0.44 202153_s_at 23636 NUP62 NM_0165 1873.97 2816.31 1952.46 0.69 1873.97 3418.31 1641.28 0.48 207758_at 9647 PPM1F NM_0250 26.35 89.57 62.25 0.69 26.35 44.72 34.09 219288_at 57415 C3orfl4 NM_0206 699.06 1097.64 763.02 0.70 699.06 1133.14 864.49 217344_at 2229 FDPSL AL02216 17.20 79.57 55.32 0.70 17.20 47.86 78.75 211734_s_at 2205 FCER1 BO00591 17.35 28.27 19.66 0.70 17.35 22.27 18.70 217578_at 7514 XPO1 AW57687 17.42 31.53 21.93 0.70 17.42 27.50 13.39 0.49 204116_at 3561 IL2RG NM_0002 92.60 246.00 171.22 0.70 92.60 376.96 259.29 0.69 210556 at 4775 NFATC U85430 77.19 148.23 103.21 0.70 77.19 82.31 90.46 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa TMAA TMAA Control LPS TMAA TMAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 210408_s_at 9362 CPNE6 AB00928 4.49 12.99 9.05 0.70 4.49 4.85 3.57 214618_at 8837 CFLAR AF01545 9.87 31.97 22.28 0.70 9.87 5.81 31.64 214343_s_at 222255 ATXN7 A1017382 52.37 91.80 63.98 0.70 52.37 49.84 38.69 / L I ///

205237_at 2219 FCN1 NM_0020 3.99 29.59 20.63 0.70 3.99 10.70 14.67 205414sat 9912 KIAAO NM0148 48.82 78.12 54.50 0.70 48.82 47.12 63.57 210271_at 4761 NEUR AB02174 23.19 37.91 26.45 0.70 23.19 29.18 22.76 202875_s_at 5089 PBX2 BE39771 294.09 465.56 324.89 0.70 294.09 357.83 439.61 220113_x_at 84172 POLR1 NM_0190 256.95 415.65 290.08 0.70 256.95 310.41 253.47 208519_x_at 2797 GNRH2 NM_0015 24.16 62.16 43.40 0.70 24.16 8.30 22.42 215996_at A1446234 20.24 60.88 42.53 0.70 20.24 9.09 21.65 204575_s_at 4327 /// MMP19 NM0024 40.59 153.74 107.44 0.70 40.59 115.04 142.93 205810_s_at 8976 WASL NM_0039 9.21 15.01 10.49 0.70 9.21 9.28 10.75 213339_at 57212 KIAAO AB00796 4.85 14.33 10.02 0.70 4.85 3.39 15.79 222367_at 123720 WHDC A1921841 27.52 49.30 34.49 0.70 27.52 47.56 37.50 WHDC

WHDC

202612_s_at 9282 CRSP2 NM_0042 10.57 34.96 24.46 0.70 10.57 13.94 6.92 208385_at 10002 NR2E3 NM_0163 12.25 27.65 19.35 0.70 12.25 10.73 31.10 211524_at 4791 NFKB2 U09609 7.25 33.99 23.79 0.70 7.25 22.40 18.46 202573 at 1455 CSNK1 AL53044 739.18 1157.56 811.77 0.70 739.18 783.40 701.67 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 219815_at 79690 GAL3S NM_0246 7.79 34.14 23.95 0.70 7.79 28.10 11.07 0.39 214245_at 6208 RPS14 A1734124 38.44 62.38 43.82 0.70 38.44 50.88 69.66 206888_s_at 398 ARHG NM_0011 43.64 79.24 55.66 0.70 43.64 10.95 46.39 43934_at 56834 GPR13 AA47949 103.17 176.44 123.95 0.70 103.17 95.46 82.15 209325_s_at 6004 RGS16 U94829 54.35 705.07 495.85 0.70 54.35 202.77 525.09 200799_at 3303 HSPA1 NM_0053 1731.57 3603.51 2534.45 0.70 1731.57 1558.32 3436.70 215926_x_at 6621 SNAPC AK02351 173.53 390.00 274.39 0.70 173.53 415.34 401.38 215491_at 4610 MYCL A1273812 32.29 82.32 57.93 0.70 32.29 46.20 41.30 207979_s_at 926 CD8B NM_0049 6.30 13.00 9.15 0.70 6.30 3.51 10.97 203060_s_at 9060 PAPSS NM_0046 173.75 274.97 193.64 0.70 173.75 799.55 281.77 0.35 212466_at 200734 SPRED AW13890 88.45 137.26 96.72 0.70 88.45 141.53 148.36 204687_at 25849 DKFZP NM_0153 67.65 104.66 73.75 0.70 67.65 253.99 331.38 216756_at AK02499 14.65 47.22 33.29 0.70 14.65 36.12 33.85 207749_s_at 5523 PPP2R3 NM_0027 108.09 177.74 125.34 0.71 108.09 265.00 162.78 0.61 209700_x_at 9659 PDE4D AB04255 16.02 27.28 19.26 0.71 16.02 46.00 81.08 222082_at 51341 ZBTB7 A1568395 36.44 57.42 40.55 0.71 36.44 23.16 58.37 A

202828sat 4323 MMP14 NM 0049 177.23 397.93 281.14 0.71 177.23 123.47 160.18 208526_at 26211 OR2F1 NM_0123 3.84 31.67 22.39 0.71 3.84 17.23 11.98 0.70 222272_x_at 85477 SCIN BG28358 23.03 62.73 44.46 0.71 23.03 42.05 27.60 0.66 214102 at 116984 CENTD AK02373 105.60 175.15 124.14 0.71 105.60 187.22 152.88 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 220658_s_at 56938 ARNTL NM_0201 169.38 289.53 205.21 0.71 169.38 221.27 200.56 208222_at 91 ACVR1 NM_0203 26.84 51.57 36.58 0.71 26.84 36.30 10.73 208729 x at 3106 HLA-B D83043 5128.16 8066.14 5723.93 0.71 5128.16 5663.19 7587.90 210162_s_at 4772 NFATC U08015 225.35 448.14 318.04 0.71 225.35 460.85 474.70 213060_s_at 1117 CHI3L2 U58515 27.54 47.50 33.71 0.71 27.54 36.76 47.84 206818_s_at 54805 CNNM NM_0176 42.84 77.56 55.06 0.71 42.84 69.79 58.98 205707_at 23765 IL17RA NM0143 1085.55 1641.52 1165.83 0.71 1085.55 811.14 500.43 209082_s_at 80781 COL18 AF01808 54.12 104.13 73.97 0.71 54.12 72.40 48.81 Al 1 213503_x_at 302 ANXA BE90821 2409.95 5924.72 4209.75 0.71 2409.95 9550.19 6945.62 0.73 206512_at 7310 U2AF1 NM_0050 42.28 88.95 63.22 0.71 42.28 82.91 156.40 211544_s_at 2692 GHRH AB05889 19.35 52.71 37.48 0.71 19.35 18.42 26.14 216738_at 3269 HRH1 AK02455 18.91 60.19 42.83 0.71 18.91 41.72 18.14 0.43 206023_at 10874 NMU NM_0066 5.57 25.45 18.11 0.71 5.57 8.84 8.67 207328_at 246 ALOX1 NM_0011 9.50 14.52 10.33 0.71 9.50 8.12 6.93 216662_at 4648 MYO7 AK00014 9.69 48.75 34.70 0.71 9.69 19.62 23.19 220027_s_at 54922 RASIPI NM_0178 22.59 38.03 27.10 0.71 22.59 10.95 23.04 220762sat 54584 GNB1L NM 0224 71.47 151.97 108.46 0.71 71.47 160.83 81.86 0.51 205479_s_at 5328 PLAU NM_0026 328.74 609.31 435.17 0.71 328.74 1710.50 5039.60 207644_at 8928 FOXH1 NM_0039 20.29 32.44 23.19 0.71 20.29 32.93 7.91 0.24 222038_s_at 51096 UTP18 AA99309 21.39 41.09 29.38 0.71 21.39 31.54 36.47 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 211317_s_at 8837 CFLAR AF04146 422.39 932.17 666.58 0.72 422.39 1157.89 1851.36 210538_s_at 330 BIRC3 U37546 30.89 602.11 430.60 0.72 30.89 1431.13 1068.78 0.75 217161xat 176 AGC1 X17406 15.56 63.17 45.22 0.72 15.56 36.67 47.88 210412_at 2904 GRIN2 U11287 25.81 46.16 33.06 0.72 25.81 5.87 5.68 B
214486xat 8837 CFLAR AF04145 218.81 575.70 412.73 0.72 218.81 900.37 851.11 216683_at 6902 TBCA AL35394 44.55 115.59 82.92 0.72 44.55 79.97 117.89 211691_x_at 4946 OAZ1 AF29333 47.28 116.92 83.87 0.72 47.28 52.36 60.19 202015_x_at NM_0068 16.29 34.09 24.46 0.72 16.29 30.26 19.42 0.64 216182_at 8871 SYNJ2 AK02675 3.81 16.23 11.65 0.72 3.81 4.79 4.34 221205_at NM_0180 122.51 299.38 215.02 0.72 122.51 306.62 68.72 0.22 222137_at 54862 CC2D1 AK02339 22.45 38.39 27.59 0.72 22.45 20.82 32.54 209999_x_at 8651 SOCS1 AB00504 5.83 27.74 19.94 0.72 5.83 5.18 9.28 204091_at 5147 PDE6D NM_0026 451.23 703.39 505.73 0.72 451.23 443.35 448.02 213665_at 6659 SOX4 A1989477 12.12 23.66 17.01 0.72 12.12 57.44 30.21 0.53 210997 at 3082 HGF M77227 4.14 13.85 9.96 0.72 4.14 14.31 12.80 212080_at 4297 MLL AV71402 283.66 448.78 322.84 0.72 283.66 381.89 321.51 211875_x_at 56106 PCDH AF15250 8.55 16.65 11.98 0.72 8.55 4.14 2.59 214286_at 2779 GNAT1 X63749 12.71 20.17 14.52 0.72 12.71 13.90 15.13 221085_at 9966 TNFSF NM_0051 8.80 20.63 14.85 0.72 8.80 24.56 10.05 0.41 209267_s_at 64116 SLC39 AB04012 1635.93 2844.81 2048.19 0.72 1635.93 4808.74 3856.87 215648_at 23386 NUDC AU14432 25.16 77.11 55.57 0.72 25.16 30.41 30.58 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 217525_at 283298 OLFM AW30509 5.75 19.19 13.83 0.72 5.75 2.08 8.02 209210_s_at 10979 PLEKH Z24725 56.67 118.90 85.72 0.72 56.67 100.19 167.64 211195_s_at 8626 TP73L AF11677 6.25 19.12 13.79 0.72 6.25 22.64 8.11 0.36 215499_at 5606 MAP2 AA78038 182.54 460.47 332.07 0.72 182.54 617.86 825.58 216290_x_at 1804 DPP6 AK00086 15.93 26.70 19.27 0.72 15.93 22.96 27.65 206862_at 9534 ZNF25 NM_0048 46.65 70.24 50.71 0.72 46.65 56.73 30.82 213428_s_at 1291 COL6A AA29237 438.55 938.69 677.63 0.72 438.55 3655.70 1864.75 0.51 215746_at 8602 C4orf9 L34409 8.12 25.55 18.44 0.72 8.12 13.67 8.54 0.62 208926_at 4758 NEU1 U84246 1604.71 2448.22 1767.75 0.72 1604.71 1619.31 3343.65 207030_s_at 1466 CSRP2 NM_0013 48.31 111.01 80.19 0.72 48.31 149.19 159.50 201590_x_at 302 ANXA NM_0040 2409.73 5747.46 4152.64 0.72 2409.73 9510.93 6896.18 0.73 207535_s_at 4791 NFKB2 NM 0025 139.41 902.97 652.74 0.72 139.41 1117.81 1464.21 204261_s_at 5664 PSEN2 AA71665 50.50 85.16 61.64 0.72 50.50 12.15 36.70 209098_s_at 182 JAG1 U73936 35.69 127.71 92.43 0.72 35.69 33.00 89.02 211171_s_at 10846 PDE10 AB02681 13.95 35.66 25.81 0.72 13.95 18.90 23.73 207232_s_at 9666 DZIP3 NM_0146 38.22 105.69 76.53 0.72 38.22 18.12 27.74 217377_x_at 4916 NTRK3 AF04181 39.30 66.21 47.95 0.72 39.30 50.71 43.68 221996_s_at 1212 CLTB AW17054 19.37 42.67 30.90 0.72 19.37 40.90 32.15 207825_s_at 2692 GHRH NM_0008 6.05 10.50 7.60 0.72 6.05 3.71 7.87 200986_at 710 SERPI NM_0000 15.14 44.75 32.42 0.72 15.14 25.12 24.94 220338 at 55103 RALGP NM 0180 26.80 53.88 39.03 0.72 26.80 33.05 32.84 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 211126_s_at 1466 CSRP2 U46006 52.36 91.81 66.53 0.72 52.36 85.38 72.83 219474_at 79669 C3orf52 NM 0246 8.92 44.75 32.43 0.72 8.92 51.14 57.45 215611_at 6938 TCF12 AU14658 222.71 340.01 246.53 0.73 222.71 304.64 180.51 209683_at 81553 FAM49 AA24365 44.97 92.36 67.02 0.73 44.97 40.93 92.65 210427_x_at 302 ANXA BC00138 2547.05 6066.78 4402.80 0.73 2547.05 9806.56 7091.67 0.72 216832_at 862 RUNX1 AF01828 3.98 32.05 23.26 0.73 3.98 8.57 37.80 Ti 3 205192_at 9020 MAPS NM_0039 46.53 97.49 70.76 0.73 46.53 219.31 183.82 208240_s_at 2246 FGF1 NM_0133 17.00 29.36 21.32 0.73 17.00 11.33 31.57 207662_at 6899 TBX1 NM_0059 39.67 60.62 44.14 0.73 39.67 44.68 21.03 206458_s_at 7482 WNT2 NM 0244 5.76 11.09 8.07 0.73 5.76 11.49 10.21 217192_s_at 639 PRDM1 AL02206 126.87 342.39 249.38 0.73 126.87 779.61 928.47 214617_at 5551 PRF1 A1445650 29.24 71.34 51.97 0.73 29.24 73.46 36.46 0.50 202643_s_at 7128 TNFAI A1738896 312.99 3082.51 2245.80 0.73 312.99 3593.12 3504.58 205938_at 22843 PPM1E NM_0149 33.99 65.46 47.69 0.73 33.99 13.33 56.25 202339_at 8189 SYMP NM_0048 133.93 242.65 176.90 0.73 133.93 111.83 129.42 215577_at 7324 UBE2E AU14679 180.70 374.26 272.86 0.73 180.70 235.88 267.04 213248_at 221362 LOC22 AL57702 123.28 284.56 207.53 0.73 123.28 135.07 79.46 210831_s_at 5733 PTGER L27489 12.76 30.14 21.98 0.73 12.76 17.53 27.07 201505_at 3912 LAMB NM_0022 23.77 38.44 28.08 0.73 23.77 208.19 279.87 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 204888_s_at 9148 NEURL AF02972 36.39 54.96 40.14 0.73 36.39 37.50 6.15 211175_at 11250 GPR45 U92642 7.68 15.92 11.63 0.73 7.68 6.61 2.47 210717_at AF11665 59.74 117.80 86.09 0.73 59.74 61.98 72.92 213285_at 161291 TMEM AV69149 1.17 25.10 18.35 0.73 1.17 21.13 7.88 0.37 219125_s_at 55974 RAG1A NM_0188 168.92 278.15 203.41 0.73 168.92 156.94 175.81 220514_at NM_0185 7.93 16.45 12.03 0.73 7.93 6.32 6.59 216166_at 399 RHOH AK02490 11.46 23.08 16.90 0.73 11.46 14.07 39.95 216961_s_at 219464 RPAIN M69039 13.06 23.82 17.44 0.73 13.06 10.66 20.69 214449_s_at 23433 RHOQ NM_0122 206.49 343.30 251.43 0.73 206.49 238.15 330.53 210597_x_at 5542/// PRB1 K03206 37.29 112.61 82.49 0.73 37.29 56.94 35.33 0.62 208597_at 1270 CNTF NM_0006 4.15 21.29 15.59 0.73 4.15 7.40 12.45 215754_at 950 SCARB AU14804 82.00 146.92 107.65 0.73 82.00 99.96 55.50 212143_s_at 3486 IGFBP3 BF34022 74.80 3263.19 2391.41 0.73 74.80 5049.49 4818.18 214878 at 256112 ZNF37 AU11816 11.28 37.39 27.41 0.73 11.28 15.59 16.74 B

218690_at 8572 PDLIM NM_0036 15.56 37.51 27.50 0.73 15.56 6.25 15.55 204735_at 5141 PDE4A NM_0062 176.91 293.85 215.50 0.73 176.91 397.51 260.30 0.65 203962_s_at 10529 NEBL NM_0063 55.10 122.55 89.88 0.73 55.10 85.79 58.86 0.69 222351_at 5519 PPP2R1 AW00988 37.76 81.19 59.55 0.73 37.76 39.04 62.35 209604 s at 2625 GATA3 A1796169 17.30 37.85 27.79 0.73 17.30 5.89 34.18 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 217239xat 54504 CPVL AF04459 28.25 45.19 33.19 0.73 28.25 17.13 32.54 206140_at 9355 LHX2 NM_0047 616.12 1806.76 1330.17 0.74 616.12 3969.65 1537.51 0.39 215540_at 6955 TRA@ AW95086 9.67 18.26 13.44 0.74 9.67 29.82 12.99 0.44 202509sat 7127 TNFAI A1862445 75.77 308.86 227.45 0.74 75.77 298.03 231.05 206380_s_at 5199 CFP NM_0026 568.57 884.27 651.42 0.74 568.57 723.19 625.69 211562_s_at 25802 LMOD BO00175 4.98 12.19 8.98 0.74 4.98 2.67 15.51 210701_at 10428 CFDP1 D85939 114.69 264.71 195.15 0.74 114.69 136.68 192.28 203125xat 4891 SLC11 AF04699 145.10 241.83 178.30 0.74 145.10 293.44 452.97 215139_at 9639 ARHG AL13750 11.84 43.15 31.83 0.74 11.84 14.58 18.67 209032sat 23705 IGSF4 AF13281 45.27 69.45 51.30 0.74 45.27 70.64 71.10 215676_at 2972 BRF1 N91109 7.90 12.00 8.87 0.74 7.90 4.22 7.20 204048_s_at 9749 PHACT AA55114 1150.04 1904.21 1408.09 0.74 1150.04 2925.25 2638.90 214980_at 7337 UBE3A AF03721 78.69 124.24 91.94 0.74 78.69 75.95 103.58 207730_x_at 84717 HDGF2 NM_0179 554.00 1070.47 792.80 0.74 554.00 634.45 604.72 210911_at 84099 ID2B M96843 6.20 21.77 16.13 0.74 6.20 45.87 35.87 213935_at 51099 ABHDS AF00713 49.01 76.15 56.43 0.74 49.01 81.02 80.62 215287_at AA97542 127.18 199.13 147.59 0.74 127.18 164.54 134.28 213191_at 148022 TICAM AF07053 85.01 268.56 199.09 0.74 85.01 247.05 332.20 201958_s_at 4660 PPP1R1 NM_0024 9.53 27.57 20.46 0.74 9.53 3.26 4.25 203915_at 4283 CXCL9 NM_0024 4.66 104.97 77.88 0.74 4.66 45.12 45.89 215562 at 22996 Clorf34 AK00022 6.06 14.14 10.50 0.74 6.06 8.70 9.18 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 200706_s_at 9516 LITAF NM_0048 925.98 1700.53 1262.37 0.74 925.98 2016.91 3255.18 202625_at 4067 LYN A1356412 784.60 1348.47 1001.54 0.74 784.60 3249.61 4428.80 215887_at 11179 ZNF27 AK02712 73.49 116.69 86.72 0.74 73.49 113.96 75.56 0.66 219235_s_at 65979 PHACT NM_0239 423.25 687.48 511.22 0.74 423.25 582.92 293.31 221281_at 6714 SRC NM_0054 6.79 17.05 12.68 0.74 6.79 12.50 8.70 0.70 204174_at 241 ALOX5 NM 0016 2262.85 3704.92 2758.46 0.74 2262.85 1721.14 1584.03 206938_at 6716 SRD5A NM_0003 26.96 44.81 33.37 0.74 26.96 33.12 32.28 210654_at 8793 TNFRS AF02123 3.46 11.05 8.23 0.74 3.46 12.56 11.86 207694_at 5456 POU3F NM_0003 8.90 29.11 21.69 0.75 8.90 36.13 21.15 0.59 206573_at 3786 KCNQ3 NM_0045 60.10 101.32 75.52 0.75 60.10 197.20 185.01 210540_s_at 8702 B4GAL BC00452 70.20 107.49 80.16 0.75 70.20 169.52 215.59 215556_at 57035 Clorf63 AU15844 20.90 51.01 38.06 0.75 20.90 25.14 33.10 222214_at AK02498 314.69 540.49 403.52 0.75 314.69 261.90 333.53 210808_s_at 27035 NOX1 AF16632 5.40 35.62 26.64 0.75 5.40 33.74 32.98 205603_s_at 1730 DIAPH NM_0073 464.65 897.67 671.33 0.75 464.65 680.31 801.99 204864_s_at 3572 IL6ST BE85654 71.14 127.89 95.75 0.75 71.14 66.71 69.86 214104_at 23432 GPR16 A1703188 54.59 99.83 74.77 0.75 54.59 92.54 55.67 0.60 207795_s_at 3824 KLRD1 AB00959 3.96 11.53 8.64 0.75 3.96 6.67 29.06 206268_at 10637 LEFTY NM_0209 7.01 39.24 29.40 0.75 7.01 36.79 23.25 0.63 205242 at 10563 CXCL1 NM 0064 2.93 6.96 2.00 2.93 1873.21 32.28 0.02 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 207533_at 6346 CCL1 NM_0029 3.46 6.54 3.17 3.46 45.96 1.14 0.02 210815_s_at 10203 CALCR U17473 21.24 6.31 7.18 21.24 116.75 4.13 0.04 L

206526_at 26150 RIBC2 NM_0156 36.64 28.66 7.00 36.64 109.41 4.89 0.04 211533_at 5156 PDGFR M22734 1.41 5.14 8.82 1.41 24.09 1.22 0.05 A

213856_at 961 CD47 BG23061 1.53 8.03 5.38 1.53 36.17 1.86 0.05 220649_at NM_0248 9.33 13.12 13.43 9.33 19.80 1.02 0.05 211064_at 284443 ZNF49 BC00640 4.81 1.20 24.79 4.81 20.29 1.10 0.05 215814_at 667 DST AL04921 4.59 4.72 11.78 4.59 21.74 1.28 0.06 207901_at 3593 IL12B NM_0021 4.24 13.40 10.51 4.24 1057.89 63.74 0.06 206298_at 58504 ARHG NM_0212 2.00 3.11 1.70 2.00 79.90 4.91 0.06 208547_at 3018 HIST1 NM_0210 9.30 8.17 7.89 9.30 24.98 1.55 0.06 219935_at 11096 ADAM NM_0070 11.43 4.56 12.57 11.43 30.43 2.05 0.07 205112_at 51196 PLCE1 NM_0163 3.30 6.34 8.80 3.30 15.36 1.14 0.07 215420_at 3549 IHH BE86917 9.72 7.00 9.08 9.72 33.48 2.50 0.07 208046_at 8359 HIST1 NM_0035 13.52 10.07 16.64 13.52 28.02 2.12 0.08 221288_at 2845 GPR22 NM_0052 26.31 31.34 28.77 26.31 55.91 4.35 0.08 208488_s_at 1378 CR1 NM_0006 15.88 28.28 26.11 15.88 44.78 3.56 0.08 221175_at 80111 C3orf36 NM 0250 8.41 6.91 13.14 8.41 30.48 2.44 0.08 215957_at 7321 UBE2D AV73136 4.33 8.76 12.54 4.33 16.08 1.30 0.08 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (10ng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (10ng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 217020_at 5915 RARB X04014 22.75 11.10 9.59 22.75 39.30 3.24 0.08 219230_at 55273 TMEM NM_0182 7.17 10.72 9.09 7.17 24.12 2.01 0.08 221182_at 80133 Clorfl2 NM 0250 10.43 4.49 14.03 10.43 15.85 1.33 0.08 207016_s_at 8854 ALDH1 AB01522 2.05 4.47 4.39 2.05 66.58 5.58 0.08 210852_s_at 10157 AASS AF22918 8.75 22.62 22.24 8.75 26.45 2.22 0.08 214370_at 6279 S100A8 AW23865 97.05 52.09 34.27 97.05 356.34 30.25 0.08 220218_at 55064 C9orf68 NM_0179 6.12 2.62 1.64 6.12 12.22 1.05 0.09 211238_at 8756 ADAM AF21582 8.93 10.69 23.62 8.93 30.85 2.65 0.09 207696_at 10690 FUT9 NM_0065 1.18 3.07 1.62 1.18 10.55 0.92 0.09 215465_at 26154 ABCA1 AL08020 2.34 7.60 14.22 2.34 11.92 1.04 0.09 216223_at 1370 CPN2 J05158 7.15 2.87 8.63 7.15 24.25 2.14 0.09 216405_at 3956 LGALS M14087 9.45 5.65 8.22 9.45 46.18 4.09 0.09 207861_at 6367 CCL22 NM_0029 161.27 125.24 74.15 161.27 7023.34 623.19 0.09 207615_s_at 750 C16orf3 NM_0012 2.65 5.63 11.28 2.65 21.92 1.98 0.09 215621_s_at 3495 IGHD BG34067 3.63 5.24 7.05 3.63 46.24 4.21 0.09 203393_at 3280 HES1 BE97368 10.70 1.20 10.45 10.70 36.00 3.30 0.09 206645_s_at 190 NROB1 NM_0004 12.07 3.16 1.94 12.07 38.55 3.53 0.09 207926_at 2814 GP5 NM_0044 12.79 6.12 7.19 12.79 31.92 2.95 0.09 210895_s_at 942 CD86 L25259 38.25 14.63 32.29 38.25 96.28 8.90 0.09 206165_s_at 9635 CLCA2 NM_0065 5.74 4.51 8.60 5.74 11.98 1.13 0.09 E 216764 at 150684 COMM AK02519 11.06 11.57 3.97 11.06 19.86 1.89 0.10 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 217524xat AA01892 5.50 7.34 1.44 5.50 17.40 1.66 0.10 220830_at 50939 IMPG2 NM_0162 2.81 6.70 8.75 2.81 25.59 2.44 0.10 207465_at NM_0141 2.26 6.18 12.11 2.26 20.22 1.94 0.10 205267_at 5450 POU2A NM_0062 12.46 26.93 24.31 12.46 23.23 2.24 0.10 214073_at 220 ALDH1 BG47529 3.88 2.97 7.21 3.88 13.96 1.38 0.10 210078_s_at 7881 KCNA L39833 16.85 50.04 43.10 16.85 39.05 3.96 0.10 219857_at 79949 ClOorf8 NM_0248 2.31 4.02 2.39 2.31 14.23 1.45 0.10 220653 at 23619 ZIM2 NM0153 41.48 27.61 32.47 41.48 69.88 7.13 0.10 205960_at 5166 PDK4 NM_0026 2.59 2.75 6.29 2.59 44.19 4.57 0.10 207599_at 9313 MMP20 NM_0047 4.86 2.35 2.08 4.86 15.32 1.60 0.10 215619 at 473 RERE AU14827 4.45 4.40 2.05 4.45 18.91 2.01 0.11 222353_at 8994 LIMO1 AV72084 4.06 10.20 12.37 4.06 23.29 2.50 0.11 215853_at 10806 SDCCA AK02164 33.80 40.89 34.08 33.80 55.94 6.12 0.11 209101_at 1490 CTGF M92934 23.07 5.24 26.98 23.07 368.37 40.43 0.11 214467_at 8477 GPR65 NM_0036 63.08 41.38 38.21 63.08 140.86 15.55 0.11 208458_at 6339 SCNN1 NM_0029 7.51 4.50 9.77 7.51 29.51 3.26 0.11 212952 at 811 CALR AA91037 1744.78 841.49 1191.85 1744.78 4006.99 446.49 0.11 210834_s_at 5733 PTGER AL03142 4.55 11.37 11.05 4.55 19.20 2.16 0.11 208394xat 11082 ESM1 NM 0070 2.24 2.12 6.74 2.24 17.43 1.96 0.11 212488 at 1289 COLSA N30339 3.89 9.49 3.11 3.89 34.08 3.84 0.11 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 202310_s_at 1277 COL1A K01228 5.86 13.13 19.21 5.86 80.30 9.13 0.11 217401_at AL03555 5.60 8.79 3.42 5.60 11.74 1.35 0.11 203636_at 4281 MID1 BE96753 10.55 14.34 18.76 10.55 65.51 7.54 0.12 220877 at NM 0185 7.74 9.89 2.24 7.74 17.99 2.10 0.12 208329_at 59351 PBOV1 NM_0216 4.46 5.91 3.64 4.46 27.69 3.25 0.12 214000_s_at 6001 RGS10 A1744627 46.17 25.13 39.60 46.17 101.85 12.00 0.12 220882 at NM 0186 3.41 4.60 2.97 3.41 111.91 13.24 0.12 213755_s_at 137872 ADHFE BF43150 13.09 17.73 26.10 13.09 40.50 4.90 0.12 213964_x_at 79946 ClOorf9 A1307586 2.10 1.66 6.98 2.10 21.40 2.60 0.12 214889_at 25854 DKFZP AL08006 14.32 3.25 3.82 14.32 27.91 3.41 0.12 206069_s_at 33 ACAD NM_0016 2.39 2.05 3.28 2.39 10.40 1.30 0.12 210394_x_at 548313 SSX4 BC00532 1.87 8.11 6.97 1.87 17.25 2.16 0.13 216982xat 51412 ACTL6 U50277 5.34 4.44 7.45 5.34 13.24 1.70 0.13 B

220759 at 64184 FAM12 NM 0223 2.44 6.28 18.52 2.44 12.09 1.56 0.13 205834sat 25859 PART1 A1770098 11.84 16.34 23.40 11.84 27.34 3.55 0.13 217306 at 645749 LOC64 AL03111 5.18 15.57 12.73 5.18 23.60 3.13 0.13 213871sat 10591 C6orflO AA52344 46.45 25.19 44.27 46.45 83.50 11.44 0.14 210931_at 6049 RNF6 AF29334 3.24 4.89 1.85 3.24 12.59 1.73 0.14 216030 s at 6407 SEMG2 AL04976 3.60 3.09 13.98 3.60 30.38 4.18 0.14 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 210339_s_at 3817 KLK2 BC00519 8.22 45.01 40.89 8.22 38.68 5.36 0.14 214026_s_at 200734 SPRED A1860246 2.26 4.87 1.27 2.26 23.31 3.24 0.14 206692_at 3766 KCNJ1 NM_0022 4.22 4.80 3.59 4.22 17.37 2.42 0.14 205764_at NM_0029 4.35 5.28 3.09 4.35 21.96 3.08 0.14 205419_at 1880 EB12 NM_0049 255.75 261.91 87.33 255.75 852.74 120.26 0.14 206331_at 10203 CALCR NM_0057 19.42 23.36 6.18 19.42 143.22 20.23 0.14 205343 at 6819 SULT1 NM0010 5.74 2.18 15.63 5.74 24.45 3.46 0.14 201860_s_at 5327 PLAT NM_0009 7.32 21.56 24.05 7.32 100.69 14.28 0.14 207473_at 4295 MLN NM0024 11.58 18.81 42.05 11.58 24.61 3.53 0.14 210631_at 4763 NFl D42072 7.09 7.92 14.61 7.09 20.15 2.90 0.14 207811_at 3859 KRT12 NM_0002 1.73 3.85 1.57 1.73 19.20 2.77 0.14 207321_s_at 23457 ABCB9 NM_0196 5.23 7.04 3.46 5.23 16.01 2.31 0.14 216235_s_at 1909 EDNR S81545 20.10 18.68 28.08 20.10 43.48 6.33 0.15 A

207288_at 80161 CXYorf NM_0250 9.38 6.34 5.04 9.38 19.90 2.90 0.15 216435_at 5607 MAP2 AK02517 1.30 6.64 0.39 1.30 18.65 2.73 0.15 205374_at 6588 SLN NM 0030 18.84 29.69 23.74 18.84 28.40 4.17 0.15 207864_at 6332 SCN7A NM_0029 4.00 2.12 2.40 4.00 17.62 2.60 0.15 222350_at 607 BCL9 AW96991 14.66 7.42 10.98 14.66 30.87 4.56 0.15 212667_at 6678 SPARC AL57592 7.43 9.22 7.46 7.43 18.63 2.75 0.15 217126 at K00627 5.23 5.75 12.19 5.23 17.64 2.61 0.15 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 221180_at 80122 YSK4 NM_0250 14.60 25.74 39.06 14.60 57.17 8.47 0.15 201416_at 6659 SOX4 NM_0031 148.60 99.80 137.83 148.60 392.36 58.16 0.15 214074_s_at 2017 CTTN BG47529 8.91 4.37 20.30 8.91 32.78 4.90 0.15 208162_s_at 55099 FLJ102 NM_0180 2.39 5.20 4.16 2.39 14.20 2.15 0.15 205597_at 80736 SLC44 NM_0252 6.91 2.92 22.26 6.91 19.19 2.92 0.15 205399_at 9201 DCAM NM_0047 1.83 1.76 1.65 1.83 13.20 2.01 0.15 218002_s_at 9547 CXCL1 AF14410 3.00 2.86 4.84 3.00 589.79 90.26 0.15 213806_at 5813 PURA BE22273 6.66 7.83 7.23 6.66 47.39 7.27 0.15 220428_at 50489 CD207 NM_0157 11.74 8.08 18.05 11.74 19.08 2.93 0.15 205620_at 2159 FlO NM_0005 7.12 15.80 15.94 7.12 14.59 2.24 0.15 205529_s_at 862 RUNX1 NM_0043 13.10 8.22 6.87 13.10 250.58 38.59 0.15 Ti 49 220401 at 79860 FLJ213 NM0248 8.28 5.68 4.34 8.28 17.77 2.75 0.15 207710_at 26239 LCE2B NM_0143 1.60 6.93 5.57 1.60 14.66 2.30 0.16 208790_s_at 284119 PTRF AF31239 17.21 10.92 28.04 17.21 36.43 5.73 0.16 219195_at 10891 PPARG NM_0132 3.79 4.92 4.29 3.79 16.01 2.53 0.16 215678 at 440792 LOC44 AB05144 21.38 11.43 6.70 21.38 34.02 5.40 0.16 206048_at 58495 OVOL2 NM_0212 7.06 8.74 18.75 7.06 14.90 2.36 0.16 220551_at 57084 SLC17 NM_0203 8.16 3.85 19.98 8.16 22.01 3.50 0.16 206065_s_at 1807 DPYS NM_0013 9.17 3.69 4.49 9.17 82.41 13.20 0.16 206909_at AF06886 9.84 12.72 9.25 9.84 21.17 3.40 0.16 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 206144_at 9223 MAGI1 NM_0047 1.68 3.25 3.11 1.68 11.64 1.88 0.16 217169_at 3493 IGHA1 M31949 13.76 9.29 13.34 13.76 25.97 4.20 0.16 210993_s_at 4086 SMAD U54826 14.71 22.00 2.50 14.71 26.78 4.35 0.16 207178_s_at 2444 FRK NM_0020 0.85 6.65 1.60 0.85 28.65 4.68 0.16 208131_s_at 5740 PTGIS NM_0009 11.40 4.49 29.49 11.40 40.16 6.58 0.16 211274_at 6899 TBX1 AF01213 5.88 11.06 26.86 5.88 17.48 2.88 0.16 217426_at L11372 7.25 6.86 23.14 7.25 36.10 5.95 0.16 207097_s_at 10246 SLC17 NM 0058 12.15 14.23 8.44 12.15 26.05 4.30 0.17 216462_at X79200 2.04 5.32 9.55 2.04 10.20 1.70 0.17 208183_at 6870 TACR3 NM_0010 11.48 25.88 25.95 11.48 20.45 3.43 0.17 205908_s_at 4958 OMD NM_0050 1.91 4.37 4.10 1.91 18.65 3.14 0.17 37892_at 1301 COL11 J04177 3.39 4.84 1.90 3.39 10.84 1.83 0.17 Al 217689_at 5770 PTPN1 BG10955 6.99 3.74 2.80 6.99 17.35 2.93 0.17 216185_at 10690 FUT9 BC00187 5.09 4.00 4.70 5.09 11.52 1.96 0.17 208471_at 3250 HPR NM_0209 5.06 23.85 17.93 5.06 22.71 3.91 0.17 206528_at 7225 TRPC6 NM_0046 6.90 4.37 15.12 6.90 14.83 2.57 0.17 205815_at 5068 REG3A NM_0025 8.92 17.49 14.83 8.92 19.74 3.42 0.17 221846_s_at 57513 CASKI A1970096 26.83 26.35 12.92 26.83 112.50 19.50 0.17 219614_s_at 54716 SLC6A NM_0202 3.56 3.79 4.21 3.56 16.12 2.79 0.17 205863_at 6283 S100A1 NM_0056 66.09 59.11 38.25 66.09 515.83 89.58 0.17 213397 x at 6038 RNASE A1761728 2.07 2.88 5.52 2.07 12.87 2.24 0.17 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 213747_at AA04723 315.44 147.79 570.49 315.44 1067.62 186.27 0.17 210836_x_at 5144 PDE4D AF01207 29.15 39.13 28.28 29.15 60.45 10.63 0.18 213757 at AA39394 2393.48 1651.77 2565.92 2393.48 8391.34 1487.69 0.18 201744_s_at 4060 LUM NM_0023 0.37 1.17 0.63 0.37 25.70 4.56 0.18 220231_at 10842 C7orfl6 NM_0066 13.68 49.24 42.07 13.68 193.09 34.45 0.18 208105_at 2696 GIPR NM_0001 14.84 8.24 7.34 14.84 31.72 5.67 0.18 211959_at 3488 IGFBP5 AW00753 5.17 18.35 16.85 5.17 218.01 39.11 0.18 214176_s_at 57326 PBXIPI A1348545 196.90 92.43 162.05 196.90 459.56 83.74 0.18 202835_at 10907 TXNL4 BO00104 38.95 27.16 56.43 38.95 124.33 22.75 0.18 200865_at A1001896 4.64 2.75 3.44 4.64 15.74 2.89 0.18 205163_at 29895 MYLPF NM_0132 23.78 21.01 8.06 23.78 57.41 10.58 0.18 210640_s_at 2852 GPR30 U63917 11.00 8.27 18.88 11.00 20.53 3.80 0.19 208098_at 442192 OR5V1 NM_0308 1.24 3.03 5.65 1.24 13.79 2.55 0.19 207631_at 10230 NBR2 NM_0058 22.40 32.64 58.94 22.40 34.25 6.36 0.19 214935_at 23636// NUP62 BE79496 8.23 12.22 9.93 8.23 38.87 7.22 0.19 220111_s_at 57101 TMEM NM_0203 6.22 5.82 8.71 6.22 11.75 2.19 0.19 206328_at 1013 CDH15 NM_0049 3.35 2.94 3.93 3.35 11.87 2.22 0.19 206407_s_at 6357 CCL13 NM_0054 32.00 21.50 33.31 32.00 64.22 12.12 0.19 216649 at 6239 RREB1 AF07282 3.17 5.68 5.50 3.17 11.98 2.26 0.19 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 214217_at 2915 GRM5 D60132 3.19 2.08 1.47 3.19 17.57 3.34 0.19 210373_at 10641 TUSC4 AF04070 11.47 12.99 14.43 11.47 23.87 4.55 0.19 220433_at 79057 PRRG3 NM_0240 8.64 6.28 12.15 8.64 19.81 3.78 0.19 205101_at 4261 CIITA NM_0002 9.09 6.20 7.09 9.09 34.78 6.66 0.19 216987_at 3662 IRF4 D78261 2.16 1.84 0.62 2.16 19.18 3.69 0.19 214644_at 8330 HIST1 BF06107 8.10 6.77 4.53 8.10 19.06 3.69 0.19 209547_s_at 57794 SF4 BO00104 25.31 20.05 16.50 25.31 66.37 12.99 0.20 207489_at 80052 FLJ123 NM_0249 12.21 13.81 27.22 12.21 29.52 5.79 0.20 206705_at 7287 TULP1 NM_0033 11.15 12.61 14.49 11.15 39.08 7.67 0.20 219728_at 9499 MYOT NM_0067 3.09 3.62 13.34 3.09 22.62 4.45 0.20 215183_at AF09088 10.72 7.42 20.86 10.72 39.25 7.74 0.20 221395_at 50838 TAS2R NM_0239 3.30 4.05 3.70 3.30 13.83 2.73 0.20 214776xat 9942 XYLB AA77779 5.12 14.72 24.05 5.12 28.33 5.61 0.20 220265_at 57720 GPR10 NM_0209 20.75 31.14 34.05 20.75 32.82 6.52 0.20 218517_at 79960 PHF17 NM_0249 671.89 541.57 620.61 671.89 3234.03 645.07 0.20 213991_s_at 9957 HS3ST BF94071 16.80 9.92 5.45 16.80 31.00 6.19 0.20 208339_at 353515 XKRY NM_0046 1.77 6.40 9.09 1.77 15.95 3.19 0.20 219768_at 79679 VTCN1 NM_0246 7.04 26.08 19.70 7.04 26.59 5.33 0.20 218974_at 55084 FLJ101 NM 0180 222.38 310.14 140.60 222.38 485.33 97.37 0.20 206618 at 8809 IL18R1 NM 0038 6.10 156.73 122.43 6.10 214.33 43.08 0.20 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 217345_at U91640 2.59 8.63 19.63 2.59 16.96 3.41 0.20 210049_at 462 SERPI D29832 8.65 11.33 4.76 8.65 19.46 3.92 0.20 207024_at 1144 CHRN NM_0007 21.20 3.50 11.38 21.20 35.01 7.10 0.20 215768_at 6660 SOX5 AL04933 261.96 376.89 230.64 261.96 1435.56 292.59 0.20 215181_at 64405 CDH22 AF03530 4.05 9.69 4.56 4.05 24.42 4.98 0.20 220332_at 10686 CLDN1 NM_0065 6.96 10.59 9.02 6.96 18.69 3.82 0.20 220330_s_at 64092 SAMS NM_0221 299.66 283.79 140.95 299.66 4794.99 979.81 0.20 Ni 36 215618_at 6251 RSU1 AK02410 13.95 15.40 32.54 13.95 34.33 7.05 0.21 220418_at 51098 // IFT52 NM_0189 1.80 6.21 2.53 1.80 20.92 4.30 0.21 UBAS

209985_s_at 429 ASCL1 BC00163 11.20 13.94 6.81 11.20 26.33 5.45 0.21 220984_s_at 81796 SLCOS NM_0309 5.65 4.67 14.49 5.65 32.62 6.77 0.21 Al 58 201286_at 6382 SDC1 Z48199 6.04 6.77 1.92 6.04 12.55 2.61 0.21 207748_at NM_0141 15.39 16.95 43.66 15.39 56.06 11.66 0.21 208413_at 5915 RARB NM_0158 2.15 4.01 3.06 2.15 10.33 2.15 0.21 207703_at 22829 NLGN4 NM_0148 79.40 98.88 108.46 79.40 564.37 118.03 0.21 211083_s_at 9175 MAPS Z25428 1.33 2.63 6.52 1.33 12.08 2.54 0.21 214375_at 440091 PPFIBP A1962377 69.98 62.54 97.33 69.98 178.23 37.50 0.21 LOCI
219064_at 80760 ITIHS NM_0305 5.73 3.79 9.11 5.73 18.69 3.94 0.21 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 217082_at U82306 4.93 2.01 8.21 4.93 15.90 3.37 0.21 207688_s_at 3626 INHBC NM 0055 327.66 191.98 326.23 327.66 619.35 131.36 0.21 213774_s_at AW61457 4.03 6.26 6.70 4.03 14.53 3.10 0.21 206344_at 5444 PON1 U53784 10.98 11.36 7.03 10.98 16.90 3.61 0.21 220717_at 80070 ADAM NM_0250 7.96 8.10 13.19 7.96 23.35 5.00 0.21 207744_at NM0141 1.74 0.95 5.13 1.74 11.11 2.39 0.21 215514_at AL08007 5.34 9.83 11.46 5.34 16.28 3.51 0.22 216558_x_at AF04459 8.61 4.05 14.62 8.61 26.20 5.69 0.22 208512_s_at 4301 MLLT4 NM_0059 5.48 6.08 12.11 5.48 16.17 3.52 0.22 220959_s_at 29989 // OBP2B NM_0145 12.73 9.84 7.55 12.73 30.86 6.75 0.22 216704 at 6902 TBCA AL35394 4.35 10.14 13.34 4.35 21.21 4.65 0.22 204388_s_at 4128 MAOA NM 0002 1.23 3.23 7.34 1.23 13.35 2.95 0.22 219529_at 9022 /// CLIC3 NM_0046 3.99 9.37 0.95 3.99 20.79 4.60 0.22 RABEP

220313_at 54112 GPR88 NM_0220 140.60 189.27 109.25 140.60 688.55 152.32 0.22 217561_at 796 CALC BF44727 10.92 8.14 4.82 10.92 17.97 3.98 0.22 215307_at 57711 ZNF52 AL10972 16.02 10.53 26.57 16.02 25.91 5.74 0.22 220392_at 64641 EBF2 NM_0226 3.92 3.87 3.17 3.92 10.08 2.24 0.22 210664_s_at 7035 TFPI AF02183 6.05 10.38 31.32 6.05 34.95 7.80 0.22 203432 at 7112 TMPO AW27261 775.83 593.57 714.25 775.83 1280.81 287.30 0.22 208075 s at 6354 CCL7 NM 0062 3.14 12.34 9.73 3.14 26.25 5.90 0.22 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 220616 at NM 0064 19.78 8.07 48.79 19.78 57.14 12.87 0.23 203295_s_at 477 ATP1A NM_0007 24.20 7.78 9.26 24.20 37.13 8.38 0.23 208416_s_at 6710 SPTB NM_0003 21.16 16.14 46.95 21.16 55.42 12.57 0.23 213979_s_at 1487 CTBP1 BF98443 766.52 549.77 790.85 766.52 1794.22 407.70 0.23 201340_s_at 8507 ENC1 AF01031 71.63 61.36 7.00 71.63 120.85 27.48 0.23 221765 at A1378044 167.05 244.29 252.38 167.05 1035.54 237.06 0.23 215036 at A1952772 10.40 7.19 15.22 10.40 33.59 7.71 0.23 216995_x_at 23609 MKRN X06409 2.68 7.51 5.44 2.68 17.02 3.92 0.23 220825_s_at 55243 KIRRE NM_0182 4.23 3.87 6.69 4.23 10.05 2.32 0.23 207731 at NM 0201 5.86 7.35 3.54 5.86 11.27 2.61 0.23 220502_s_at 6561 SLC13 AF26082 3.52 4.09 12.12 3.52 17.15 3.97 0.23 Al 4 214101_s_at 728896 LOC72 BG15339 137.38 136.88 180.71 137.38 533.68 123.56 0.23 210382_at 6344 SCTR U13989 8.09 6.06 6.03 8.09 36.49 8.46 0.23 207256 at 4153 MBL2 NM 0002 2.50 1.33 4.14 2.50 10.44 2.44 0.23 221529_s_at 83483 PLVAP AF32659 11.30 7.18 25.72 11.30 28.83 6.76 0.23 209690_s_at 55715 DOK4 BC00354 6.83 10.54 8.79 6.83 27.09 6.41 0.24 210861_s_at 8838 WISP3 AF14367 2.09 1.21 7.79 2.09 13.25 3.17 0.24 220657_at 55175 KLH 1 NM_0181 7.81 6.55 6.63 7.81 23.72 5.69 0.24 209290_s_at 4781 NFIB BC00128 5.22 5.72 13.05 5.22 26.40 6.33 0.24 210356 x at 931 MS4A1 BC00280 7.05 9.75 23.10 7.05 11.77 2.83 0.24 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 214587_at 1295 COL8A BE87779 10.90 16.26 6.51 10.90 19.94 4.80 0.24 213565_s_at 4091 SMAD A1193899 10.35 12.84 13.06 10.35 28.61 6.91 0.24 216456_at 5101 PCDH9 AL16204 7.61 10.97 6.21 7.61 21.07 5.09 0.24 220334_at 26575 RGS17 NM 0124 4.67 18.44 27.58 4.67 45.54 11.02 0.24 216124_at 54879 ST7L AK02415 13.20 8.80 12.57 13.20 22.08 5.34 0.24 215927_at 10564 ARFGE AV65760 6.00 8.79 12.23 6.00 23.67 5.73 0.24 214142_at 123887 ZG16 A1732905 6.01 6.78 8.19 6.01 22.17 5.37 0.24 206080_at 9651 PLCH2 NM_0146 5.81 5.60 4.44 5.81 17.57 4.27 0.24 205326_at 10268 RAMPS NM_0058 30.47 13.41 35.39 30.47 46.09 11.22 0.24 222062_at 9466 IL27RA A1983115 193.02 338.97 259.12 193.02 2386.38 583.92 0.24 209888_s_at 4632 MYL1 M20643 3.85 5.66 4.67 3.85 10.77 2.64 0.24 220595_at 29951 PDZRN NM_0133 7.48 10.67 3.92 7.48 13.90 3.41 0.25 205572_at 285 ANGPT NM_0011 8.61 7.15 15.35 8.61 28.81 7.10 0.25 215432_at 116285 ACSM1 AC00303 6.62 5.97 13.02 6.62 12.53 3.09 0.25 210080_x_at 10136 ELA3A D00306 14.51 8.79 4.88 14.51 25.96 6.44 0.25 203398_s_at 2591 GALN NM_0044 7.66 38.18 29.55 7.66 30.22 7.50 0.25 206439_at 1833 EPYC NM_0049 6.75 3.28 1.90 6.75 15.50 3.85 0.25 206598_at 3630 INS NM_0002 3.02 2.70 2.00 3.02 18.42 4.57 0.25 220676_at 11095 ADAM NM_0070 5.35 4.47 16.73 5.35 25.79 6.41 0.25 210665_at 7035 TFPI AF02183 5.80 8.57 5.04 5.80 22.17 5.51 0.25 213655_at 5048 PAFAH AA50264 2539.35 1808.95 2842.37 2539.35 7026.66 1754.25 0.25 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 218875_s_at 26271 FBXO5 NM 0121 594.34 574.83 520.55 594.34 1893.84 473.23 0.25 207145_at 2660 GDF8 NM_0052 2.84 2.28 4.17 2.84 10.33 2.58 0.25 218574sat 29995 LMCD NM0145 23.55 4.03 17.24 23.55 46.87 11.73 0.25 207038_at 9120 SLC16 NM_0046 6.97 34.06 28.86 6.97 23.55 5.89 0.25 206721 at 57821 Clorfll NM 0211 10.31 2.87 6.29 10.31 22.21 5.57 0.25 207669_at 3889 KRT83 NM_0022 5.60 6.60 6.45 5.60 18.63 4.67 0.25 202969_at A1216690 284.42 326.45 231.60 284.42 616.25 155.30 0.25 221872_at 5918 RARRE A1669229 0.95 7.19 22.24 0.95 13.73 3.46 0.25 204198sat 864 RUNX3 AA54163 804.37 1177.81 431.84 804.37 1672.19 424.29 0.25 211161_s_at 1281 COL3A AF13008 3.16 3.75 5.35 3.16 20.76 5.27 0.25 221698sat 64581 CLEC7 AF31346 42.75 59.27 51.05 42.75 173.71 44.19 0.25 215360 at AK02206 1.37 1.37 4.89 1.37 13.55 3.45 0.25 211348sat 8555 CDC14 AF06410 21.81 5.56 12.85 21.81 33.15 8.45 0.25 221884_at 2122 EVIL BE46652 8.67 5.58 14.16 8.67 15.88 4.05 0.25 200761_s_at 10550 ARL6I NM_0064 2021.41 2829.28 2410.96 2021.41 3837.72 980.80 0.26 205102_at 7113 TMPRS NM_0056 10.49 5.08 19.42 10.49 21.90 5.60 0.26 214418_at 196993 LOC19 A1656822 5.48 6.03 2.89 5.48 10.05 2.57 0.26 214862_x_at AL08008 2.29 6.41 4.25 2.29 13.63 3.50 0.26 217194_at 9462 RASAL AB00797 2.86 9.03 13.06 2.86 10.85 2.79 0.26 218413 s at 51193 ZNF63 NM 0163 9.14 5.19 20.07 9.14 39.77 10.24 0.26 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa TMAA TMAA Control LPS TMAA TMAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 206027_at 6274 S100A3 NM_0029 28.61 28.50 13.55 28.61 81.06 20.98 0.26 205674_x_at 486 FXYD2 NM_0016 22.37 29.36 27.36 22.37 85.81 22.41 0.26 205809_s_at 8976 WASL BE50497 111.25 90.27 153.75 111.25 240.88 62.99 0.26 213868_s_at 51635 DHRS7 AW24312 2.80 7.04 6.93 2.80 11.65 3.05 0.26 206167_s_at 395 ARHG NM_0011 3.65 19.02 20.45 3.65 64.74 16.96 0.26 210025_s_at 29775 CARD1 AW20515 16.25 22.02 35.74 16.25 60.78 16.00 0.26 205629_s_at 1392 CRH BC00259 11.88 16.57 4.74 11.88 25.96 6.84 0.26 209854_s_at 3817 KLK2 AF18874 5.18 3.03 2.57 5.18 14.86 3.92 0.26 221997_s_at 122704 MRPLS A1560951 110.57 75.97 120.11 110.57 183.34 48.45 0.26 206824_at 51716 CES4 NM_0162 4.98 5.15 2.55 4.98 17.68 4.67 0.26 207925_at 1473 CSTS NM_0019 8.59 3.74 31.35 8.59 15.42 4.08 0.26 216600_x_at AK02641 50.51 67.20 54.99 50.51 76.01 20.11 0.26 209335_at 1634 DCN BC00532 9.45 16.25 20.72 9.45 30.15 7.98 0.26 207395_at 696 BTN1A NM_0017 4.95 5.50 8.07 4.95 15.30 4.06 0.27 217481xat 388336 FLJ454 AL11020 15.87 20.39 16.45 15.87 31.98 8.49 0.27 214468_at 4624 MYH6 D00943 3.84 6.60 8.61 3.84 24.96 6.63 0.27 206616_s_at 53616 ADAM AF15538 5.67 3.75 3.53 5.67 11.44 3.04 0.27 206683_at 7718 ZNF16 NM_0034 16.95 23.59 18.69 16.95 46.90 12.48 0.27 220862_s_at 23326 USP22 NM_0140 13.23 8.50 4.20 13.23 28.35 7.57 0.27 220872 at 55415 PR029 NM 0185 44.15 37.40 33.91 44.15 124.12 33.27 0.27 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 1320_at 11099 PTPN2 X79510 4.10 14.79 17.18 4.10 20.28 5.44 0.27 207929_at 2925 GRPR NM_0053 12.63 23.86 37.49 12.63 35.34 9.48 0.27 220114_s_at 55576 STAB2 NM_0175 30.48 20.22 30.38 30.48 50.95 13.67 0.27 202489_s_at 5349 FXYD3 BC00523 7.01 4.63 5.16 7.01 49.52 13.29 0.27 210750_s_at 9229 DLGAP AB00027 13.66 6.37 36.86 13.66 52.95 14.24 0.27 212533_at 7465 WEE1 X62048 740.96 666.06 664.70 740.96 1614.33 435.31 0.27 206021_at 54581 SCAN NM_0220 9.69 11.16 8.56 9.69 19.97 5.39 0.27 208247 at 711 C3orf51 NM 0012 4.74 1.98 4.78 4.74 14.60 3.98 0.27 206392_s_at 5918 RARRE NM_0028 8.04 1.67 6.79 8.04 28.04 7.67 0.27 214388_at 10443 PFAAP A1732885 56.87 77.68 82.68 56.87 134.22 36.79 0.27 215145sat 26047 CNTN AC00537 7.58 4.27 4.30 7.58 11.89 3.26 0.27 202600_s_at 8204 NRIP1 A1824012 695.26 743.82 853.54 695.26 3249.25 892.90 0.27 203424_s_at 3488 IGFBP5 AW15754 3.79 22.29 21.70 3.79 72.37 19.93 0.28 207799_x_at NM_0154 24.85 18.13 6.90 24.85 49.19 13.56 0.28 201242_s_at 481 ATP1B B000000 751.38 1068.01 600.04 751.38 11642.50 3222.21 0.28 216217_at 23228 PLCL2 AK02354 9.08 14.39 39.09 9.08 20.86 5.77 0.28 207315_at 10666 CD226 NM_0065 8.96 7.90 8.80 8.96 16.30 4.53 0.28 216240_at 5820 PVT1 M34428 5.56 9.88 18.54 5.56 34.97 9.71 0.28 206035_at 5966 REL NM_0029 24.22 12.38 20.40 24.22 331.30 92.07 0.28 221795 at 4915 NTRK2 AA70719 4.24 3.95 3.10 4.24 14.43 4.01 0.28 207415 at 22925 PLA2R NM 0073 5.81 3.64 2.72 5.81 13.21 3.69 0.28 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 216864_at U05589 8.67 4.20 2.79 8.67 13.95 3.89 0.28 211567_at J04168 2.33 5.41 4.93 2.33 11.84 3.32 0.28 216190_x_at 3688 ITGB1 AA21585 6.44 4.31 25.88 6.44 15.82 4.43 0.28 211131sat 1896 EDA AF06119 4.77 26.98 25.43 4.77 20.71 5.81 0.28 208303_s_at 64109 CRLF2 NM_0221 16.51 7.18 8.63 16.51 1356.51 381.58 0.28 208232xat 3084 NRG1 L12260 12.44 43.25 33.69 12.44 37.46 10.54 0.28 216642_at 6397 SEC14 AL11019 22.54 25.08 13.40 22.54 37.62 10.60 0.28 212827_at 3507 IGHM X17115 15.53 21.19 13.40 15.53 65.44 18.48 0.28 204591_at 10752 CHL1 NM_0066 4.95 8.02 7.14 4.95 20.37 5.75 0.28 208004_at 58503 PROL1 NM_0212 14.22 36.53 29.12 14.22 40.19 11.40 0.28 207887_s_at 799 CALCR AB02217 5.05 14.08 11.84 5.05 26.49 7.56 0.29 204814_at 8618 CADPS NM_0037 8.11 5.96 23.10 8.11 29.57 8.46 0.29 37996_s_at 1760 DMPK L08835 72.89 100.17 52.84 72.89 110.11 31.49 0.29 218350_s_at 51053 GMNN NM_0158 870.50 736.93 698.81 870.50 1727.31 494.58 0.29 219804_at 79933 SYNPO NM_0248 2.59 1.83 1.02 2.59 13.90 3.99 0.29 221273_s_at 727800 LOC72 NM_0312 21.10 21.42 15.67 21.10 36.39 10.46 0.29 209816_at 5727 PTCH1 AL04417 10.00 5.16 10.88 10.00 24.92 7.17 0.29 216803_at 10611 PDLIM AK02721 5.28 14.04 16.42 5.28 11.18 3.22 0.29 205828_at 4314 MMP3 NM_0024 13.63 13.06 21.41 13.63 23.26 6.71 0.29 220249_at 23553 HYAL4 NM_0122 7.20 7.28 2.48 7.20 28.92 8.37 0.29 211201 at 2492 FSHR M95489 6.10 3.63 2.28 6.10 19.21 5.56 0.29 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 219739_at 54546 RNF18 NM_0190 7.82 5.51 8.38 7.82 18.93 5.49 0.29 211403_x_at 26609 // VCY AF16707 15.03 10.65 26.10 15.03 30.62 8.91 0.29 209924_at 6362 CCL18 AB00022 5.01 8.22 3.71 5.01 35.20 10.24 0.29 205514_at 55786 ZNF41 NM 0183 1.70 1.56 1.47 1.70 15.58 4.54 0.29 219585_at 79140 CCDC2 NM_0242 7.89 8.44 7.73 7.89 17.29 5.04 0.29 206109_at 2523 FUT1 NM_0001 19.28 38.51 53.68 19.28 62.90 18.33 0.29 204184_s_at 157 ADRB NM_0051 135.61 147.65 260.75 135.61 215.58 62.91 0.29 209740_s_at 8228 PNPLA U03886 11.84 14.37 40.29 11.84 31.67 9.26 0.29 213765_at 8076 MFAPS AW66589 5.45 6.98 3.18 5.45 21.59 6.31 0.29 207331_at 1063 CENPF NM_0163 39.68 61.25 58.36 39.68 60.75 17.78 0.29 216108 at AU14701 12.31 2.04 9.10 12.31 19.45 5.70 0.29 216784 at AK02542 17.39 4.52 29.39 17.39 38.10 11.18 0.29 215748_at 283212 FLJ337 AL05037 6.42 9.30 23.55 6.42 36.45 10.70 0.29 222337_at 114883 OSBPL AW96821 25.07 35.61 27.75 25.07 50.29 14.80 0.29 211148sat 285 ANGPT AF18785 4.10 3.82 12.64 4.10 12.25 3.62 0.30 216778sat 1538 CYLC1 Z22780 3.82 15.76 13.38 3.82 14.75 4.37 0.30 212923sat 221749 C6orfl4 AK02482 61.65 189.49 144.47 61.65 1582.04 469.53 0.30 205805_s_at 4919 ROR1 NM_0050 12.55 13.97 9.88 12.55 19.30 5.75 0.30 213906_at 4603 MYBL AW59226 363.55 455.99 206.56 363.55 611.58 182.64 0.30 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 214077xat 4213 MEIS3 H15129 189.79 245.42 198.01 189.79 381.83 114.12 0.30 207982_at 3010 HIST1 NM_0053 19.26 14.47 17.82 19.26 54.57 16.36 0.30 221204_s_at 55118 CRTAC NM_0180 17.94 20.34 31.82 17.94 45.97 13.89 0.30 206093_x_at 7148 TNXB NM_0071 6.80 15.62 13.63 6.80 21.78 6.58 0.30 209074_s_at 11170 FAM10 AF08985 3.00 7.21 1.94 3.00 17.86 5.40 0.30 208389_s_at 6506 SLC1A NM_0041 10.38 7.55 35.09 10.38 46.41 14.04 0.30 214464 at 8476 CDC42 NM 0036 15.67 10.70 13.80 15.67 23.78 7.19 0.30 219602_s_at 63895 FAM38 AW26981 58.88 86.45 36.48 58.88 115.47 34.99 0.30 213962_s_at 23141 KIAAO A1924382 16.60 9.97 34.09 16.60 38.22 11.58 0.30 217206_at D00267 13.50 9.39 17.16 13.50 34.63 10.50 0.30 208265_at 56918 DKFZp NM_0201 2.47 4.08 6.57 2.47 16.82 5.12 0.30 207500_at 838 CASPS NM_0043 11.33 15.19 12.14 11.33 69.59 21.32 0.31 213350_at 6205 RPS11 BF68025 522.85 650.26 632.61 522.85 1583.80 485.58 0.31 217460_at 7142 TNP2 X63759 4.90 5.01 17.20 4.90 20.34 6.24 0.31 220907_at 266977 GPR11 NM_0250 10.97 23.38 19.46 10.97 19.55 6.02 0.31 208382_s_at 11144 DMC1 NM_0070 5.84 16.49 25.88 5.84 26.24 8.08 0.31 213573_at AA86160 513.04 429.35 294.03 513.04 925.56 285.39 0.31 213306_at 8777 MPDZ AA91789 7.02 3.95 2.60 7.02 30.84 9.52 0.31 214182 at 382 ARF6 AA24314 651.99 537.07 751.31 651.99 2197.77 679.05 0.31 217332_at 647288 LOC64 AL13301 9.71 9.52 9.16 9.71 30.15 9.32 0.31 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 206946_at 10021 HCN4 NM_0054 13.59 4.80 10.52 13.59 24.47 7.58 0.31 214944_at 23035 PHLPP AK00185 5.05 3.85 12.01 5.05 34.90 10.81 0.31 215417_at 23233 EXOC6 A1803703 8.77 12.13 9.54 8.77 16.96 5.26 0.31 B

210498_at 1213 CLTC AF13006 5.41 4.41 7.39 5.41 25.68 7.97 0.31 203844_at 7428 VHL NM_0005 2.39 10.46 9.02 2.39 24.05 7.46 0.31 213705_at AW30186 127.37 89.65 121.65 127.37 276.88 86.04 0.31 213258_at 7035 TFPI BF51123 15.91 39.97 30.15 15.91 82.52 25.70 0.31 211266_s_at 2828 GPR4 U35399 11.30 12.25 16.11 11.30 25.51 7.97 0.31 208229_at 2263 FGFR2 NM_0229 81.11 68.49 96.56 81.11 141.64 44.29 0.31 215298_at U79300 6.89 9.82 17.53 6.89 27.16 8.51 0.31 214391_x_at 5731 PTGER A1762344 14.66 11.33 10.32 14.66 28.55 8.97 0.31 204871_at 7978 MTERF NM_0069 132.49 135.92 147.33 132.49 309.83 97.41 0.31 217554_at AV71935 61.28 69.60 87.23 61.28 252.86 79.69 0.32 210374_x_at 5733 PTGER D38300 20.97 26.75 27.04 20.97 38.35 12.10 0.32 211413_s_at 23569 PADI4 AF22906 2.14 6.32 6.88 2.14 10.50 3.32 0.32 212372 at 4628 MYH10 AK02697 333.25 341.82 245.40 333.25 752.49 237.95 0.32 220923_s_at 29944 PNMA NM_0133 21.89 37.09 45.05 21.89 42.88 13.60 0.32 204069_at 4211 MEIS1 NM_0023 3.14 3.09 5.46 3.14 21.60 6.85 0.32 219900_s_at 55663 ZNF44 NM_0179 29.67 25.80 54.96 29.67 47.50 15.07 0.32 211848 s at 1087 CEAC AF00662 12.22 2.08 9.93 12.22 20.52 6.52 0.32 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 202191_s_at 8522 GAS7 BE43998 259.02 363.60 322.08 259.02 549.39 175.24 0.32 203863 at NM 0011 7.32 5.41 4.31 7.32 15.23 4.88 0.32 221131 at 51146 A4GNT NM 0161 23.52 13.63 44.66 23.52 51.14 16.42 0.32 209905_at 3205 HOXA A1246769 1336.86 1328.69 1205.90 1336.86 2314.70 744.44 0.32 220316 at 64067 NPAS3 NM 0221 6.17 4.88 23.19 6.17 34.56 11.11 0.32 214253sat 1838 DTNB A1672185 7.17 12.94 15.91 7.17 12.10 3.89 0.32 206915 at 4821 NKX2- NM 0025 5.74 8.40 7.53 5.74 15.61 5.03 0.32 209640_at 5371 PML M79462 103.93 152.75 52.72 103.93 161.12 52.02 0.32 214071 at 65258 MPPE1 A1082827 4.98 4.67 21.53 4.98 13.49 4.37 0.32 217384xat 3576 IL8 AJ275374 5.03 3.46 3.73 5.03 29.54 9.58 0.32 204134_at 5138 PDE2A NM_0025 5.69 8.74 16.12 5.69 13.72 4.46 0.32 216566_at D84140 7.95 8.95 5.72 7.95 17.59 5.72 0.33 219493_at 79801 SHCBP NM_0247 909.34 971.91 874.17 909.34 1517.50 494.29 0.33 213609_s_at 23544 SEZ6L AB 02314 13.11 23.86 19.65 13.11 33.07 10.78 0.33 200938_s_at 473 RERE A1920976 7.75 7.65 2.65 7.75 25.51 8.32 0.33 202517_at 1400 CRMP1 NM_0013 15.83 22.69 26.13 15.83 31.26 10.20 0.33 216609_at 7295 TXN AF06524 300.13 264.66 432.34 300.13 866.37 283.09 0.33 221222_s_at 54964 Clorf56 NM_0178 161.08 189.41 223.25 161.08 581.43 190.02 0.33 209529_at 8612 PPAP2 AF04776 6.36 5.52 5.90 6.36 36.40 11.90 0.33 217504 at 23460 ABCA6 AA09935 15.12 15.97 15.05 15.12 44.34 14.49 0.33 207977_s_at 1805 DPT NM_0019 4.94 3.09 12.24 4.94 27.25 8.92 0.33 213387 at 54454 ATAD2 AB03306 432.35 479.83 550.43 432.35 1079.37 353.82 0.33 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 221682_s_at 56100 PCDH AF13515 3.09 3.29 3.87 3.09 15.01 4.93 0.33 208003_s_at 10725 NFAT5 NM_0065 111.69 183.35 294.93 111.69 1165.92 384.13 0.33 217526_at 84901 NFATC A1478300 908.12 990.46 727.01 908.12 1459.88 481.18 0.33 205839_s_at 9256 BZRAP NM_0047 116.03 105.86 46.45 116.03 216.00 71.22 0.33 213872 at 81688 C6orf62 BE46503 4467.07 3291.94 4231.06 4467.07 12032.13 3979.21 0.33 207386_at 9420 CYP7B NM_0048 56.11 104.17 87.13 56.11 695.28 230.00 0.33 209071_s_at 8490 RGS5 AF15957 140.34 118.62 82.31 140.34 233.03 77.16 0.33 215450_at W87901 639.72 381.40 669.98 639.72 987.74 327.24 0.33 217115_at AL03168 9.70 9.55 3.21 9.70 16.53 5.48 0.33 216058_s_at 1557 CYP2C X65962 8.87 19.70 17.86 8.87 34.18 11.42 0.33 214057_at 4170 MCL1 H71805 195.42 199.20 194.76 195.42 326.34 109.24 0.33 214640_at 54346 UNC93 AL02133 0.99 6.45 21.82 0.99 17.46 5.86 0.34 201996_s_at 23013 SPEN AL52403 381.63 394.58 479.29 381.63 942.35 316.24 0.34 213344sat 3014 H2AFX H51429 120.93 133.97 157.21 120.93 223.29 74.95 0.34 201645 at 3371 TNC NM 0021 6.94 31.79 29.12 6.94 131.77 44.27 0.34 205934_at 5334 PLCL1 NM_0062 5.30 5.74 14.52 5.30 51.15 17.21 0.34 205978_at 9365 KL NM_0047 25.59 8.20 23.07 25.59 39.47 13.28 0.34 216972_at 6677 SPAM1 L13779 2.62 9.30 15.14 2.62 17.41 5.88 0.34 208610_s_at 23524 SRRM2 A1655799 1427.12 1168.86 1364.26 1427.12 2409.21 814.03 0.34 208417_at 2251 FGF6 NM_0209 36.94 54.61 51.29 36.94 84.36 28.67 0.34 220326 s at 55701 FLJ103 NM 0180 429.44 555.41 333.11 429.44 736.94 250.54 0.34 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 212524_x_at 3014 H2AFX AA76086 23.77 11.49 21.80 23.77 36.95 12.56 0.34 219912_s_at NM_0050 11.29 15.07 20.40 11.29 17.42 5.93 0.34 205507_at 22899 ARHG NM_0149 23.23 26.16 14.73 23.23 36.70 12.51 0.34 215951_at 23102 TBC1D AL13730 11.55 14.61 23.73 11.55 19.07 6.50 0.34 208377_s_at 778 CACN NM 0051 5.04 4.45 5.17 5.04 10.57 3.61 0.34 222183_x_at 22938 SNW1 AL39015 82.73 103.80 73.58 82.73 236.25 80.60 0.34 215198_s_at 800 CALD1 AU14740 18.54 4.85 9.83 18.54 30.40 10.38 0.34 204515_at 3283 HSD3B NM_0008 4.44 11.33 13.05 4.44 17.76 6.08 0.34 210357_s_at 54498 SMOX BC00066 66.63 86.93 75.62 66.63 524.99 179.82 0.34 206897_at 8712 PAGE1 NM 0037 8.41 40.30 32.65 8.41 34.41 11.79 0.34 216792_at AK02686 18.65 33.57 31.05 18.65 49.35 16.93 0.34 214329xat 8743 TNFSF AW47443 151.51 178.28 68.69 151.51 433.65 148.93 0.34 60794_f at 400721 LOC40 A1400621 356.46 239.02 331.46 356.46 623.85 214.26 0.34 208465_at 2912 GRM2 NM_0008 7.79 16.53 14.58 7.79 14.96 5.14 0.34 212732_at 55384 MEG3 A1950273 15.23 25.15 28.80 15.23 31.46 10.81 0.34 208155_x_at 2543 /// GAGE1 NM_0014 9.84 8.04 30.01 9.84 49.98 17.22 0.34 GAGES
210483_at 254896 MGC31 BO00504 19.25 9.94 14.77 19.25 49.42 17.04 0.34 207181 s at 840 CASP7 NM 0012 199.41 273.14 181.19 199.41 439.34 151.80 0.35 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 217195_at L42230 17.67 25.91 25.78 17.67 32.57 11.26 0.35 215103_at 1562 CYP2C AW19291 9.33 3.30 3.14 9.33 19.68 6.81 0.35 222161_at 10003 NAAL AJ012370 1.77 1.26 1.96 1.77 15.60 5.41 0.35 215674_at 85373 KIAA1 AB05144 8.80 12.26 16.16 8.80 15.42 5.35 0.35 216550_x_at 23253 ANKR X80821 196.14 195.58 256.91 196.14 371.92 129.14 0.35 221387_at 64106 NPFFR NM_0221 27.32 30.67 40.07 27.32 60.87 21.14 0.35 218963_s_at 25984 KRT23 NM_0155 5.73 2.59 5.20 5.73 19.36 6.75 0.35 215058_at 160518 MGC24 AU14404 33.68 35.36 15.58 33.68 71.97 25.15 0.35 214495_at 10369 CACN NM_0060 4.65 4.70 3.04 4.65 14.24 4.98 0.35 216285_at 8220 DGCR1 AL13771 3.98 10.95 17.29 3.98 12.68 4.44 0.35 201893_x_at 1634 DCN AF13830 19.80 13.96 30.66 19.80 89.35 31.29 0.35 213710_s_at AL52327 348.81 270.83 187.51 348.81 637.83 223.75 0.35 209587_at 5307 PITX1 U70370 10.52 3.90 5.44 10.52 18.31 6.43 0.35 216910_at 7512 XPNPE AF19595 17.00 4.10 3.52 17.00 27.17 9.55 0.35 202023_at 1942 EFNA1 NM_0044 4.86 3.99 14.49 4.86 19.13 6.72 0.35 214316_x_at 811 CALR A1378706 199.68 206.15 199.34 199.68 370.83 130.51 0.35 216834_at 5996 RGS1 S59049 7.14 9.99 3.55 7.14 93.55 32.97 0.35 217303_s_at 155 ADRB3 X70812 3.75 6.15 3.42 3.75 10.34 3.65 0.35 206986_at 728985 LOC72 AB00742 16.61 15.65 18.93 16.61 34.67 12.25 0.35 208327_at 1553 CYP2A NM_0007 6.81 7.84 8.79 6.81 14.40 5.09 0.35 213002 at 4082 MARC AA77059 370.19 489.58 1055.64 370.19 2017.85 714.48 0.35 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 215282_at 25847 ANAP BE67749 5.91 5.95 6.73 5.91 13.08 4.63 0.35 217006_x_at U52428 10.10 8.02 10.17 10.10 17.38 6.16 0.35 210718_s_at 51326 ARL17 AF11988 14.94 24.37 24.62 14.94 28.28 10.03 0.35 205665_at 10867 TSPAN NM_0066 10.18 13.77 28.16 10.18 22.39 7.95 0.36 220017_x_at 1559 CYP2C NM_0007 7.86 8.50 5.59 7.86 28.00 9.96 0.36 206555_s_at 55623 THUM NM_0177 940.98 866.21 958.89 940.98 1978.37 703.71 0.36 201890_at 6241 RRM2 BE96623 3071.14 3710.39 2785.24 3071.14 8099.15 2881.88 0.36 221968_s_at 51333 ZNF77 AW01437 4.06 8.94 3.05 4.06 14.87 5.29 0.36 206794_at 2066 ERBB4 NM_0052 9.87 16.07 24.06 9.87 22.16 7.92 0.36 217258xat 3712 IVD AF04358 4.47 5.58 3.34 4.47 15.85 5.67 0.36 205523_at 1404 HAPLN U43328 5.27 3.68 3.97 5.27 16.08 5.75 0.36 205179_s_at 101 ADAM A1814527 9.57 9.98 11.66 9.57 25.65 9.19 0.36 220422_at 50613 UBQL NM_0174 4.26 5.90 8.50 4.26 13.85 4.96 0.36 222237_s_at 7771 ZNF22 AC08423 10.39 5.86 1.98 10.39 15.89 5.70 0.36 213904_at AL39017 6.41 7.16 2.18 6.41 29.24 10.49 0.36 221334_s_at 50943 FOXP3 NM_0140 13.69 17.98 14.22 13.69 42.24 15.24 0.36 204511_at 9855 FARP2 NM_0148 19.61 22.92 43.63 19.61 40.91 14.76 0.36 220563_s_at 50944 SHAN NM_0161 5.28 7.48 22.93 5.28 17.38 6.28 0.36 212924sat 25804 LSM4 N37057 19.72 22.11 16.08 19.72 40.62 14.72 0.36 220318_at 55040 EPN3 NM_0179 3.63 4.45 22.15 3.63 10.33 3.75 0.36 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 214676_x_at 57876 MUC3 AF11361 5.04 9.67 20.68 5.04 21.70 7.88 0.36 201205_at AF00675 74.84 86.79 59.19 74.84 114.24 41.55 0.36 204863_s_at 3572 /// IL6ST BE85654 76.81 107.86 161.33 76.81 126.00 45.85 0.36 MAGE

202743_at 8503 PIK3R3 BE62262 180.26 182.78 177.64 180.26 303.90 110.66 0.36 208475_at 55691 FRMD4 NM_0180 10.54 8.48 22.45 10.54 40.18 14.64 0.36 211010_s_at 259197 NCR3 AF03113 5.40 3.95 3.98 5.40 10.75 3.92 0.37 205378_s_at 43 ACHE NM_0158 13.73 3.61 7.30 13.73 26.60 9.73 0.37 204636_at 1308 COL17 NM_0004 4.91 4.80 5.16 4.91 10.80 3.95 0.37 Al 94 211813_x_at 1634 DCN AF13830 4.70 9.69 2.65 4.70 22.83 8.38 0.37 203443 at 256364 EML3 AB01292 3.94 6.30 8.37 3.94 14.74 5.42 0.37 219692_at 79412 KREM NM_0245 11.95 19.09 29.50 11.95 86.90 31.96 0.37 213048_s_at 6418 SET W26593 9208.00 6033.37 8658.77 9208.00 15146.32 5612.76 0.37 209297_at 6453 ITSN1 AF11448 86.55 18.49 30.93 86.55 168.69 62.52 0.37 217681_at 647836 WNT7 BE73699 7.96 4.86 19.28 7.96 29.00 10.77 0.37 209869_at 150 ADRA2 AF28409 11.63 3.30 30.99 11.63 27.61 10.28 0.37 211867sat 56139 PCDH AF15247 4.45 8.98 38.48 4.45 14.66 5.47 0.37 AlO 5 218829sat 55636 CHD7 A1475906 326.71 342.47 271.31 326.71 836.14 313.27 0.37 201372sat 8452 CUL3 AU14523 26.77 44.53 44.71 26.77 49.16 18.50 0.38 220411 x at 79883 PODNL NM 0248 49.87 66.89 76.29 49.87 84.49 31.84 0.38 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 217061_s_at 2115 ETV1 AC00485 6.46 9.05 7.30 6.46 21.22 8.00 0.38 221383_at 10316 NMUR NM_0060 6.97 7.96 7.68 6.97 13.07 4.94 0.38 211726_s_at 2327 FMO2 BC00589 25.42 16.53 27.82 25.42 44.26 16.87 0.38 213928_s_at 3267 HRB A1742626 32.74 16.92 30.17 32.74 71.28 27.23 0.38 209613_s_at 125 ADH1B M21692 6.29 1.79 2.03 6.29 12.06 4.62 0.38 207244xat 1548 CYP2A NM 0007 14.24 34.95 94.24 14.24 56.36 21.59 0.38 205814_at 2913 GRM3 NM_0008 6.86 6.00 11.54 6.86 19.30 7.42 0.38 207015_s_at 8854 ALDH1 AB01522 4.60 3.38 6.32 4.60 31.35 12.06 0.38 208410_x_at 265 AMEL NM_0011 8.39 2.14 7.54 8.39 19.05 7.33 0.38 209773_s_at 6241 RRM2 BC00188 1867.24 2216.54 1532.67 1867.24 3367.85 1299.07 0.39 209633_at 5523 PPP2R3 AL38997 131.13 294.89 253.58 131.13 764.33 294.90 0.39 203535_at 6280 S100A9 NM_0029 1263.49 1163.30 1045.22 1263.49 3171.00 1225.31 0.39 207610_s_at 30817 EMR2 NM_0134 94.47 125.29 59.34 94.47 249.34 96.83 0.39 214052_x_at 23215 BAT2D AW23863 149.09 158.40 262.06 149.09 382.59 148.64 0.39 207931_s_at 5208 PFKFB NM_0062 12.56 50.71 56.20 12.56 58.13 22.64 0.39 205576_at 3053 SERPI NM_0001 9.86 5.57 4.10 9.86 43.03 16.80 0.39 215151_at 55619 DOCK1 AB01459 24.13 71.37 55.78 24.13 57.01 22.28 0.39 205180_s_at 101 ADAM NM_0011 16.30 61.13 50.65 16.30 99.62 38.95 0.39 220246_at 57118 CAMK NM_0203 9.06 24.85 40.97 9.06 30.15 11.81 0.39 215725_at 25786 DGCR1 L77561 15.18 71.39 78.99 15.18 75.80 29.69 0.39 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 213171_s_at 10893 MMP24 AL12175 6.12 7.71 4.79 6.12 16.87 6.61 0.39 220729_at NM_0140 31.59 11.78 32.52 31.59 66.41 26.05 0.39 217439_at AL12212 2.70 13.68 22.54 2.70 23.61 9.30 0.39 220803_at 57559 STAM NM_0175 3.00 3.98 5.83 3.00 16.53 6.51 0.39 221018_s_at 56165 TDRD1 NM_0312 2.90 6.63 11.57 2.90 13.84 5.46 0.39 203407_at 5493 PPL NM_0027 2.92 5.10 7.59 2.92 11.66 4.60 0.39 205099sat 1230 CCR1 AI421071 804.75 1012.48 541.74 804.75 1440.10 570.64 0.40 207775_at 79150 MGC48 NM_0243 4.36 9.06 8.16 4.36 10.46 4.15 0.40 211428_at 5265 SERPI AF11987 4.03 3.20 5.74 4.03 16.60 6.58 0.40 203058_s_at 9060 PAPSS AW29995 79.27 90.71 68.55 79.27 375.47 149.15 0.40 60084_at 1540 CYLD AI453099 12.53 23.80 18.53 12.53 35.76 14.21 0.40 209632_at 5523 PPP2R3 AI760130 75.46 154.21 142.61 75.46 400.92 159.37 0.40 A

215552_s_at 2099 ESR1 AI073549 4.14 2.41 15.34 4.14 10.02 3.98 0.40 205034_at 9134 CCNE2 NM0047 1116.62 1437.07 698.33 1116.62 2004.21 797.88 0.40 203687_at 6376 CX3CL NM_0029 10.84 8.12 4.80 10.84 22.94 9.18 0.40 206430_at 1044 CDX1 NM 0018 12.44 32.40 31.28 12.44 31.23 12.51 0.40 210575_at 10726 NUDC AF24178 7.05 7.31 5.79 7.05 20.65 8.30 0.40 213808_at BE67446 1.09 4.72 3.15 1.09 20.31 8.18 0.40 210550_s_at 5923 RASGR L26584 94.20 111.73 56.90 94.20 143.98 58.08 0.40 210026_s_at 29775 CARD1 AW20515 21.18 30.96 17.66 21.18 118.17 47.70 0.40 205098 at 1230 CCR1 AI421071 1280.61 1340.44 761.52 1280.61 2817.21 1137.51 0.40 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 206297_at 11330 CTRC NM_0072 51.41 60.91 49.80 51.41 80.42 32.50 0.40 202436_s_at 1545 CYP1B AU14485 1273.78 1404.79 570.44 1273.78 3487.26 1411.86 0.40 207985_at 26237 ENO1B NM_0143 10.30 9.33 3.42 10.30 17.10 6.93 0.41 212883_at 10452 TOMM A1358867 4.36 4.49 12.30 4.36 22.58 9.15 0.41 212616_at 80205 CHD9 BF66895 1390.38 1491.23 1262.55 1390.38 2361.22 956.76 0.41 211980_at 1282 COL4A A1922605 475.72 286.61 365.89 475.72 882.69 357.69 0.41 201348_at 2878 GPX3 NM_0020 20.47 20.58 20.86 20.47 41.39 16.77 0.41 208789_at 284119 PTRF BC00429 19.22 10.73 12.27 19.22 129.45 52.49 0.41 217922 at BE54306 741.45 838.83 535.61 741.45 1578.20 640.41 0.41 216439_at 10188 TNK2 AK02490 17.26 8.49 7.98 17.26 31.64 12.87 0.41 221796_at 4915 NTRK2 AA70719 3.64 6.73 5.77 3.64 12.98 5.28 0.41 222068_s_at 123872 LRRC5 AW66363 4.83 25.80 27.87 4.83 249.46 101.58 0.41 221994_at 10611 PDLIM AA19632 16.49 36.08 32.58 16.49 33.85 13.79 0.41 204115_at 2791 GNG11 NM0041 32.07 14.31 5.25 32.07 56.54 23.06 0.41 205302_at 3484 IGFBPI NM_0005 5.25 6.77 20.29 5.25 23.84 9.73 0.41 216408_at 81697 0R2132 AJ302584 6.46 1.47 3.61 6.46 14.37 5.87 0.41 214164xat 771 CA12 BF75227 42.49 49.48 12.32 42.49 108.50 44.31 0.41 208123_at 9312 KCNB2 AF33873 5.82 8.54 13.80 5.82 24.41 9.97 0.41 204762_s_at 2775 GNAO NM_0209 19.28 28.64 13.84 19.28 33.05 13.52 0.41 214345_at BF05864 24.69 9.90 13.55 24.69 38.84 15.94 0.41 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa TMAA TMAA Control LPS TMAA TMAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 210343_s_at 9356 SLC22 AF12437 9.97 11.76 7.50 9.97 15.70 6.45 0.41 207519_at 6532 SLC6A NM_0010 10.05 6.24 13.68 10.05 28.59 11.75 0.41 221030_s_at 83478 ARHG NM_0313 17.03 21.38 19.82 17.03 89.13 36.67 0.41 216494_at 645468 LOC64 AL02377 13.30 7.00 6.72 13.30 21.64 8.92 0.41 205184_at 2786 GNG4 NM 0044 116.95 138.87 77.98 116.95 529.58 218.43 0.41 213582_at 23250 ATP11 BF43947 62.30 89.60 72.02 62.30 138.39 57.12 0.41 201130_s_at 999 CDH1 NM_0043 1.20 4.97 4.07 1.20 15.70 6.48 0.41 218044_x_at 5763 PTMS M24398 18.05 21.39 33.02 18.05 30.50 12.59 0.41 205625_s_at 793 CALB1 AW01492 0.92 2.19 3.47 0.92 12.19 5.03 0.41 202437_s_at 1545 CYP1B NM_0001 625.40 780.26 321.65 625.40 2128.34 880.49 0.41 205765_at 1577 CYP3A NM_0007 2.51 6.23 3.78 2.51 21.03 8.72 0.41 216842_x_at 159163 RBMY U38460 29.69 13.64 23.56 29.69 53.36 22.13 0.41 RBMY
IF ///
RBMY
lB

211002_s_at 23650 TRIM2 AF23038 4.84 8.94 3.99 4.84 15.29 6.35 0.42 219520_s_at 55841 WWC3 NM 0184 207.01 252.15 208.72 207.01 428.87 178.48 0.42 207222_at 8399 PLA2G NM0035 14.38 47.25 38.13 14.38 26.77 11.14 0.42 219636_s_at 80210 ARMC NM_0251 5.75 19.00 31.84 5.75 49.45 20.59 0.42 203917_at 1525 CXAD NM_0013 39.30 41.28 30.52 39.30 77.08 32.10 0.42 204491 at 5144 PDE4D R40917 133.25 174.31 211.33 133.25 452.65 188.74 0.42 209648 x at 9655 SOCSS AL13689 174.11 197.15 205.62 174.11 308.15 128.78 0.42 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 220378_at 6954 TCP11 NM0186 11.33 5.72 2.44 11.33 21.25 8.91 0.42 203921_at 9435 CHST2 NM_0042 79.60 498.72 401.55 79.60 1003.43 420.69 0.42 214660_at 53918 PELO X68742 16.48 4.64 7.45 16.48 30.51 12.80 0.42 215894_at 5729 PTGDR A1460323 7.42 5.46 10.82 7.42 11.56 4.85 0.42 205528_s_at 862 RUNX1 X79990 3.53 4.30 20.47 3.53 91.06 38.29 0.42 Ti 210610_at 634 CEAC M69176 13.88 20.35 15.83 13.88 53.82 22.65 0.42 200618_at 3927 LASP1 NM_0061 2009.27 2011.50 1515.01 2009.27 3899.85 1645.64 0.42 217244 at AL02132 2.80 2.10 1.70 2.80 13.67 5.77 0.42 201417_at 6659 SOX4 AL13617 340.42 399.80 350.07 340.42 899.40 380.77 0.42 215321_at 154661 RPIB9 A1825798 32.51 9.19 55.07 32.51 64.21 27.20 0.42 207454_at 2899 GRIK3 NM_0008 3.38 4.62 8.93 3.38 10.83 4.59 0.42 206002_at 10149 GPR64 NM_0057 10.15 30.78 31.88 10.15 29.61 12.55 0.42 206151_x_at 23436 ELA3B NM_0073 7.00 7.53 5.59 7.00 12.58 5.34 0.42 218856_at 27242 TNFRS NM_0166 652.00 768.42 677.72 652.00 2467.23 1048.09 0.42 213443 at 8717 TRAD N36774 3.48 8.92 6.89 3.48 15.94 6.78 0.43 D

211675_s_at 29969 MDFIC AF05458 1419.27 1260.63 1322.18 1419.27 7904.07 3364.37 0.43 208484 at 3024 HIST1 NM 0053 3.38 3.93 1.77 3.38 10.48 4.47 0.43 203354_s_at 23362 PSD3 NM_0153 112.90 188.34 253.36 112.90 707.21 302.01 0.43 220208_at 11093 ADAM NM_0175 33.95 41.07 57.04 33.95 62.92 26.91 0.43 203063_at 9647 PPM1F NM_0146 383.51 489.93 381.53 383.51 621.16 266.36 0.43 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 204603_at 9156 EXO1 NM_0036 625.28 614.87 484.97 625.28 1128.18 484.19 0.43 215252_at 7266 DNAJC AW81402 330.12 346.32 484.63 330.12 627.49 269.31 0.43 207311_at 8447 DOC2B NM_0035 8.97 16.99 34.64 8.97 35.37 15.20 0.43 206137_at 9699 RIMS2 NM_0146 23.93 45.32 86.23 23.93 38.87 16.71 0.43 215822_x_at 4661 MYT1 M96980 8.95 16.17 17.17 8.95 56.78 24.44 0.43 214420_s_at 1559 CYP2C AV65787 7.92 5.49 10.96 7.92 13.54 5.83 0.43 205286_at 7022 TFAP2 U85658 38.85 28.24 24.65 38.85 113.24 48.79 0.43 C

209540_at 3479 IGF1 M29644 11.09 6.04 7.71 11.09 27.62 11.91 0.43 219855_at 55190 N1JDT1 NM_0181 5.61 8.07 5.64 5.61 21.56 9.30 0.43 212927_at 23137 SMCS AW18367 221.82 271.10 221.26 221.82 445.92 192.87 0.43 215675_at 7008 TEF AB05144 4.94 5.16 7.99 4.94 26.37 11.43 0.43 206336_at 6372 CXCL6 NM_0029 7.54 2.50 26.49 7.54 1643.05 714.11 0.43 212013_at 7837 PXDN D86983 9.40 6.95 14.24 9.40 14.55 6.33 0.43 206765_at 3759 KCNJ2 AF15382 127.19 124.00 196.39 127.19 531.69 231.32 0.44 203477_at 1306 COL15 NM_0018 80.00 59.46 62.52 80.00 138.69 60.37 0.44 Al 55 210596 at AF13010 454.39 374.73 527.00 454.39 755.48 329.13 0.44 205966_at 6884 TAF13 NM_0056 20.01 12.80 22.70 20.01 45.51 19.84 0.44 210303_at 10586 MAB21 AF26203 5.40 3.92 10.70 5.40 19.36 8.46 0.44 35776 at 6453 ITSN1 AF06424 117.00 129.34 114.72 117.00 190.05 83.12 0.44 214386_at 3166 HMX1 A1939402 4.40 10.88 17.53 4.40 11.89 5.21 0.44 213277_at 677 ZFP36L A1344045 7.92 5.59 12.63 7.92 18.80 8.25 0.44 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 215538_at 730062 LOC73 BF05749 10.95 11.98 6.18 10.95 26.97 11.85 0.44 216891_at U00956 4.77 5.53 11.17 4.77 22.36 9.83 0.44 215277_at 5097 PCDH1 AA48165 9.69 3.38 6.78 9.69 41.92 18.44 0.44 207784_at 414 ARSD NM_0095 4.60 6.05 36.57 4.60 14.49 6.38 0.44 202688_at 8743 TNFSF NM_0038 412.50 502.19 210.74 412.50 775.60 341.63 0.44 210163_at 6373 CXCL1 AF03051 11.28 89.98 73.90 11.28 74.88 32.99 0.44 204146_at 10635 RAD51 BE96614 508.40 392.56 578.83 508.40 890.24 392.25 0.44 205187_at 4090 SMAD AF01060 95.62 69.51 93.56 95.62 171.06 75.40 0.44 219896_at 50632 DRD1I NM_0157 4.03 6.84 12.02 4.03 11.75 5.18 0.44 215698_at 5927 JARID1 AF00713 98.34 80.27 93.60 98.34 165.22 72.99 0.44 220362_at 170679 PSORS NM_0140 13.00 10.64 25.72 13.00 19.56 8.66 0.44 205505_at 2650 GCNT1 NM_0014 232.59 229.26 217.79 232.59 426.47 188.95 0.44 206660_at 3543 IGLL1 NM_0200 8.10 4.03 3.89 8.10 31.18 13.82 0.44 205931_s_at 9586 CREBS NM_0049 16.50 5.89 5.71 16.50 37.16 16.47 0.44 202285_s_at 4070 TACST NM_0023 8.02 17.65 18.13 8.02 39.00 17.31 0.44 212077_at 800 CALD1 AL58352 9.65 19.45 16.60 9.65 19.71 8.76 0.44 208701_at 334 APLP2 BC00037 210.25 207.51 224.80 210.25 356.38 158.69 0.45 218995_s_at 1906 EDN1 J05008 5.90 10.77 10.13 5.90 14.55 6.49 0.45 218399_s_at 55038 CDCA4 NM_0179 909.74 1088.69 908.84 909.74 1836.61 819.95 0.45 212477 at 23527 CENTB D26069 38.01 38.65 49.77 38.01 64.81 28.94 0.45 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 221816_s_at 158852 PHF11 BF05547 760.35 1093.60 863.09 760.35 1141.83 510.50 0.45 36C9.1 207501_s_at 2257 FGF12 NM_0041 1.88 7.00 6.63 1.88 14.42 6.45 0.45 213866 at 201191 SAMD AL13445 21.47 68.44 60.23 21.47 78.33 35.11 0.45 221960_s_at 5862 RAB2 A1189609 132.04 104.98 154.40 132.04 213.39 95.87 0.45 215547_at 9819 TSC22 AF20129 13.78 37.76 39.86 13.78 33.46 15.04 0.45 215610_at 728263 LOC72 AK02203 52.22 68.45 28.01 52.22 98.87 44.62 0.45 208388_at 10002 NR2E3 NM_0142 9.26 7.12 7.75 9.26 27.39 12.36 0.45 206447_at 63036 ELA2A NM_0019 2.69 6.57 1.64 2.69 16.10 7.27 0.45 216856sat AF26478 35.94 19.42 61.68 35.94 107.46 48.57 0.45 217163_at 2099 ESR1 X63118 5.38 2.41 12.26 5.38 10.05 4.54 0.45 203745_at 3052 HCCS A1801013 356.54 380.83 345.60 356.54 814.86 368.71 0.45 206020_at 9306 SOCS6 NM_0163 115.84 116.66 104.12 115.84 202.24 91.57 0.45 221912_s_at 79140 CCDC2 AL04979 31.72 36.80 62.87 31.72 56.43 25.55 0.45 222330_at 5140 PDE3B AW97499 8.56 64.82 63.97 8.56 59.50 26.95 0.45 214704_at 22980 TCF25 AK02467 9.35 9.88 11.30 9.35 14.99 6.80 0.45 215204_at 26054 SENP6 AU14729 280.16 518.45 510.30 280.16 473.39 214.66 0.45 217183_at 3949 LDLR S70123 8.35 9.65 12.06 8.35 23.01 10.44 0.45 217575_s_at 6655 SOS2 BF69295 2.55 4.81 5.58 2.55 15.29 6.95 0.45 219806_s_at 56935 Cllorf7 NM_0201 813.80 868.61 1189.71 813.80 1426.85 648.44 0.45 203425s at 3488 IGFBPS M65062 27.36 27.39 47.86 27.36 69.42 31.57 0.45 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 213832_at AA53099 23.92 4.85 1.79 23.92 43.91 20.00 0.46 209121_x_at 7026 NR2F2 M64497 64.03 69.03 48.15 64.03 145.52 66.30 0.46 213087_s_at 1936 EEF1D BF69002 79.37 48.97 70.10 79.37 132.63 60.58 0.46 208942_s_at 7095 TLOC1 U93239 2339.60 2197.18 2676.33 2339.60 5369.52 2454.47 0.46 221559_s_at 79003 MIS12 BC00022 287.87 302.62 325.60 287.87 617.00 282.21 0.46 210906_x_at 361 AQP4 U34846 3.92 2.75 5.10 3.92 10.50 4.81 0.46 206919_at 2005 ELK4 NM_0217 4.63 25.69 32.95 4.63 38.85 17.81 0.46 202687_s_at 8743 TNFSF NM_0038 216.68 253.09 115.06 216.68 338.68 155.25 0.46 213437 at 22902 RUFY3 AA86178 17.65 24.37 38.78 17.65 56.41 25.93 0.46 213951_s_at 29893 PSMC3 BE96465 249.95 319.91 280.94 249.95 559.59 257.29 0.46 222070_at 373863 DND1 AW09004 160.67 169.26 127.16 160.67 245.61 112.96 0.46 213092_x_at 23234 DNAJC AW24177 382.02 292.84 320.19 382.02 636.50 292.89 0.46 220627_at 10047 CST8 NM_0054 12.36 12.60 5.89 12.36 19.00 8.75 0.46 219973_at 79642 ARSJ NM_0245 1.61 7.93 18.04 1.61 18.20 8.39 0.46 202792sat 9701 SAPS2 NM0146 146.47 217.94 90.70 146.47 225.64 104.08 0.46 220859 at NM0141 5.44 9.37 2.72 5.44 23.20 10.71 0.46 203544_s_at 8027 STAM NM_0034 218.80 200.55 256.16 218.80 419.30 193.54 0.46 206813_at 1489 CTF1 NM_0013 5.75 7.96 9.63 5.75 10.60 4.90 0.46 219229 at 28232 SLCO3 NM 0132 344.12 546.43 561.62 344.12 782.05 361.57 0.46 Al 72 209501_at 1039 CDR2 AL58241 406.72 480.56 528.64 406.72 797.87 369.33 0.46 212620 at 23060 ZNF60 AW16597 70.02 92.79 93.35 70.02 142.24 65.85 0.46 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 211441_x_at 64816 CYP3A AF28011 6.46 8.14 0.73 6.46 13.15 6.09 0.46 222304_x_at 26628 OR7E4 AW51403 13.29 9.56 11.52 13.29 27.80 12.88 0.46 219609_at 79446 WDR25 NM_0245 19.82 11.57 12.34 19.82 36.03 16.70 0.46 221516_s_at 54471 SMCR7 BC00258 1051.50 967.40 934.79 1051.50 1937.54 899.75 0.46 202892_at 8697 CDC23 NM_0046 764.29 768.29 640.18 764.29 1204.26 559.41 0.46 213523_at 898 CCNE1 A1671049 493.85 602.45 399.25 493.85 1201.18 558.12 0.46 220420_at 79748 LMAN NM_0218 9.01 6.96 4.92 9.01 17.17 7.98 0.46 215871_at 5322 PLA2G AL15817 2.20 4.35 9.63 2.20 23.94 11.14 0.47 218623_at 51617 HMP19 NM_0159 15.56 3.63 3.13 15.56 24.20 11.27 0.47 214677xat 28786 // IGL@ X57812 13.39 17.75 8.11 13.39 20.51 9.55 0.47 211652_s_at 3929 LBP M35533 11.66 24.39 20.69 11.66 53.50 24.95 0.47 206545_at 940 CD28 NM_0061 1.37 11.63 9.81 1.37 17.41 8.12 0.47 204068_at 6788 STK3 NM_0062 609.39 661.92 1145.95 609.39 1394.06 650.54 0.47 207719_x_at 9859 CEP170 NM_0148 971.09 936.59 1042.16 971.09 1480.30 691.59 0.47 220013_at 79852 ABHD9 NM_0247 5.32 8.11 22.55 5.32 17.75 8.29 0.47 206578_at 1482 NKX2- NM_0043 10.81 7.42 9.58 10.81 23.51 10.99 0.47 212759_s_at 6934 TCF7L A1703074 15.90 11.57 15.01 15.90 42.71 20.02 0.47 204753_s_at 3131 HLF A1810712 5.84 2.18 14.68 5.84 10.81 5.08 0.47 213913_s_at 23329 KIAAO AW13497 23.11 17.80 19.53 23.11 38.51 18.10 0.47 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 216846_at 3535 IGL@ AF23425 6.09 2.99 8.14 6.09 10.78 5.08 0.47 213219_at 108 ADCY2 AB02898 6.52 11.00 9.57 6.52 13.02 6.13 0.47 201330_at 5917 RARS NM_0028 1949.10 1463.27 1700.46 1949.10 3004.78 1415.94 0.47 203753_at 6925 TCF4 NM_0031 145.94 114.22 158.65 145.94 258.80 121.99 0.47 207840_at 11126 CD160 NM_0070 19.05 12.04 10.09 19.05 38.49 18.15 0.47 206838_at 9095 TBX19 NM_0051 86.99 123.34 89.60 86.99 137.86 65.08 0.47 206933_s_at 9563 H6PD NM_0042 4.94 7.38 8.02 4.94 13.62 6.45 0.47 208615_s_at 8073 PTP4A AF20885 1057.30 1306.62 1139.73 1057.30 2562.19 1217.48 0.48 203414 at 23531 MMD NM 0123 604.70 836.25 733.27 604.70 1332.71 633.42 0.48 216286 at 9331 B4GAL AV76076 28.57 34.12 44.78 28.57 42.95 20.43 0.48 214257sat 9554 SEC22 AA89001 2185.00 1534.51 2935.81 2185.00 4901.57 2331.41 0.48 205923_at 5649 RELN NM_0050 3.60 16.30 38.60 3.60 21.45 10.25 0.48 217168_s_at 9709 HERPU AF21799 1669.26 2386.03 3476.03 1669.26 6156.64 2948.91 0.48 218249_at 64429 ZDHH NM_0224 580.61 726.38 550.70 580.61 1058.00 506.88 0.48 205159_at 1439 CSF2R AV75614 673.88 846.20 718.47 673.88 1162.18 558.04 0.48 211984_at 801 CALM A1653730 1080.10 1123.86 811.09 1080.10 2044.09 981.64 0.48 209250_at 8560 DEGS1 BC00096 2245.39 3471.41 3212.51 2245.39 9207.58 4424.00 0.48 202256_at 10421 CD2BP BF79388 178.58 267.73 123.49 178.58 312.71 150.39 0.48 200685_at 9295 SFRS11 AU14623 236.45 158.40 186.72 236.45 371.71 178.88 0.48 37547 at 27241 PTHB1 U85995 3.19 5.31 5.62 3.19 10.37 4.99 0.48 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 210057_at 23049 SMG1 U32581 95.85 141.25 119.54 95.85 224.41 108.10 0.48 213956_at 9857 CEP350 AW29929 593.86 738.43 786.34 593.86 905.12 436.09 0.48 202751 at 24144 TFIP11 NM 0121 46.26 54.31 49.87 46.26 103.54 49.90 0.48 214481_at 8336 HIST1 NM_0035 15.80 4.47 33.89 15.80 28.52 13.75 0.48 204729_s_at 6804 STX1A NM_0046 33.67 66.32 84.46 33.67 103.82 50.06 0.48 206708_at 3344 FOXN2 NM_0021 75.68 70.40 90.70 75.68 168.35 81.27 0.48 216117_at 27085 MTBP AK02511 10.22 38.67 36.82 10.22 42.34 20.50 0.48 217012_at AL08023 1.50 6.99 15.85 1.50 18.26 8.86 0.49 208176 at 26584 DUX1 NM 0121 22.57 24.42 5.20 22.57 35.70 17.33 0.49 201451_x_at 6009 RHEB D78132 10.51 14.12 30.45 10.51 75.64 36.72 0.49 221278_at 3218 HOXB8 NM_0240 4.08 2.57 15.70 4.08 17.14 8.34 0.49 202599_s_at 8204 NRIP1 NM_0034 645.40 663.59 609.51 645.40 1479.20 719.89 0.49 209043_at 9061 PAPSS AF03302 467.40 584.83 371.60 467.40 830.78 405.25 0.49 216596_at 26082 DKFZP AL11744 9.06 7.00 7.87 9.06 26.69 13.03 0.49 216557xat 2537 /// 1F16 U92706 6.06 24.01 25.75 6.06 44.38 21.68 0.49 /// I

201899_s_at 7319 UBE2A NM_0033 1836.90 1907.49 1727.04 1836.90 3167.95 1549.17 0.49 201213_at A1090331 116.62 133.61 110.86 116.62 194.86 95.57 0.49 220510_at 57127 RHBG NM_0204 11.17 8.74 9.79 11.17 16.85 8.27 0.49 217599_s_at 29969 MDFIC BE91060 118.63 81.89 90.10 118.63 574.23 281.77 0.49 218962 s at 64418 TMEM NM 0224 643.50 629.20 654.83 643.50 1087.93 534.50 0.49 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 205038_at 10320 IKZF1 BG54050 317.07 308.68 163.79 317.07 1541.16 757.29 0.49 207490_at 80086 TUBA4 NM_0250 48.59 62.15 32.35 48.59 76.47 37.58 0.49 217663_at AW26432 23.76 36.95 47.22 23.76 55.26 27.17 0.49 209555_s_at 948 CD36 BE96879 273.65 331.19 282.13 273.65 423.74 208.36 0.49 216453_at 57336 ZNF28 AL35957 10.13 10.64 25.14 10.13 19.72 9.71 0.49 204695_at 993 CDC25 A1343459 351.24 493.20 225.60 351.24 879.42 433.11 0.49 A

204789_at 752 FMNL1 NM_0058 468.33 458.86 410.11 468.33 886.29 437.39 0.49 216877_at 401014 DKFZp U80770 25.52 55.39 53.03 25.52 66.72 32.93 0.49 221439_at 10741 RBBP9 NM_0066 6.43 7.52 8.89 6.43 12.53 6.19 0.49 205894_at 415 ARSE NM_0000 17.55 11.97 7.02 17.55 35.06 17.32 0.49 211085_s_at 6789 STK4 Z25430 152.17 142.55 158.54 152.17 232.05 114.64 0.49 208086_s_at 1756 DMD M92650 8.43 4.87 7.26 8.43 27.15 13.42 0.49 211646_at L14453 2.65 1.09 0.45 2.65 16.03 7.95 0.50 206737_at 7481 WNT11 NM 0046 4.49 3.92 4.48 4.49 17.09 8.49 0.50 218324_s_at 65244 SPATS NM_0230 50.62 101.66 79.55 50.62 93.85 46.64 0.50 208110_x_at 81857 MED25 NM_0309 6.75 7.90 6.33 6.75 12.53 6.25 0.50 219790_s_at 4883 NPR3 NM_0009 7.82 11.53 3.49 7.82 17.26 8.61 0.50 215059_at 79625 C4orf3l AA05396 1.62 2.22 1.96 1.62 13.63 6.82 0.50 200914xat 3895 KTN1 NM 0049 1049.11 752.35 1272.78 1049.11 1823.45 912.58 0.50 212027 at 58517 RBM25 A1925305 860.97 770.64 725.45 860.97 1467.98 734.70 0.50 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 215685_s_at 1746 DLX2 BE79222 26.96 20.58 44.08 26.96 54.20 27.13 0.50 204461_x_at 5810 RAD1 NM_0028 782.00 679.22 754.59 782.00 1292.64 647.02 0.50 203487_s_at 25852 ARMC NM_0153 414.33 380.06 354.70 414.33 676.69 338.88 0.50 202976_s_at 22836 RHOB NM_0148 276.77 258.23 187.81 276.77 471.05 236.38 0.50 204235_s_at 51454 GULP1 AF20071 22.41 28.98 8.00 22.41 62.21 31.22 0.50 208502_s_at 5307 PITX1 NM_0026 34.58 27.12 28.72 34.58 72.79 36.57 0.50 213406_at 26118 WSB1 AA52126 66.97 43.60 68.43 66.97 103.27 51.89 0.50 204080 at 114034 TOE1 NM 0250 456.78 527.99 410.73 456.78 812.13 408.13 0.50 212766_s_at 81875 ISG20L AW29458 1031.22 1130.36 940.51 1031.22 2546.09 1281.83 0.50 221458_at 3355 HTR1F NM_0008 14.83 9.25 15.93 14.83 28.25 14.24 0.50 217005_at 3949 LDLR M28219 3.22 6.70 6.22 3.22 19.65 9.93 0.51 204268_at 6273 S100A2 NM_0059 46.22 20.03 31.12 46.22 70.24 35.50 0.51 210111_s_at 23008 KIAAO AF27717 773.86 707.52 768.96 773.86 1300.30 658.08 0.51 217643xat 440295 LOC44 AA44377 37.82 45.53 46.48 37.82 57.83 29.31 0.51 220388_at 80307 FER1L NM_0247 9.67 10.23 8.71 9.67 23.53 11.94 0.51 205596sat 64750 SMUR AY01418 752.88 766.27 1137.30 752.88 2313.63 1174.48 0.51 207675_x_at 9048 ARTN NM_0039 73.79 48.25 51.77 73.79 111.22 56.49 0.51 215474_at 286053 NSMC AK02209 9.63 60.47 84.58 9.63 60.80 30.89 0.51 221177 at 117153 MIA2 NM 0250 3.56 3.87 18.59 3.56 21.10 10.73 0.51 221367 at 4342 MOS NM 0053 17.57 13.01 26.89 17.57 27.29 13.88 0.51 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 217280_x_at 727729 LOC72 AF06178 8.02 7.00 10.31 8.02 18.62 9.47 0.51 205386_s_at 4193 MDM2 NM_0023 50.74 45.02 48.74 50.74 113.69 57.97 0.51 218874_s_at 79969 C6orfl3 NM_0249 27.90 17.85 33.20 27.90 55.88 28.50 0.51 216454_at 55621 TRMT1 AL39013 19.82 25.00 32.11 19.82 30.54 15.61 0.51 206805_at 10371 SEMA3 NM_0060 20.97 15.88 24.74 20.97 86.67 44.30 0.51 221731_x_at 1462 CSPG2 BF21892 259.21 481.92 388.87 259.21 618.55 316.16 0.51 204256_at 79071 ELOVL NM_0240 8.47 2.53 8.35 8.47 15.05 7.70 0.51 209572_s_at 8726 EED AF08022 1103.80 1447.37 1270.60 1103.80 2735.45 1399.15 0.51 210170_at 27295 PDLIM BC00101 6.07 1.30 6.38 6.07 13.08 6.69 0.51 212182_at 11163 // NUDT4 AB00795 36.36 47.89 35.39 36.36 55.54 28.45 0.51 203947_at 1479 CSTF3 NM_0013 1509.35 1518.13 884.81 1509.35 2596.15 1331.39 0.51 210929_s_at 197 AHSG AF13005 8.10 7.87 16.73 8.10 27.44 14.08 0.51 220674_at 79978 FLJ228 NM_0249 2.92 4.52 8.35 2.92 13.62 7.00 0.51 204688_at 8910 SGCE NM_0039 19.25 29.06 27.11 19.25 30.48 15.67 0.51 205438_at 11099 PTPN2 NM_0070 3.20 5.14 2.34 3.20 36.57 18.80 0.51 203910_at 9411 ARHG NM_0048 11.30 21.65 25.04 11.30 18.86 9.72 0.52 204763_s_at 2775 GNAO NM_0209 5.44 15.02 23.25 5.44 10.86 5.60 0.52 218333_at 51009 DERL2 NM_0160 361.25 381.83 491.98 361.25 697.53 359.57 0.52 219823_at 79727 LIN28 NM_0246 9.11 12.82 37.37 9.11 19.35 9.98 0.52 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 220375_s_at NM 0247 95.23 90.24 76.40 95.23 163.20 84.23 0.52 212696_s_at 6047 RNF4 BF96863 1606.31 1349.15 1241.86 1606.31 2520.53 1301.46 0.52 214857_at 79946 ClOorf9 AL05003 58.45 78.22 47.86 58.45 179.88 93.26 0.52 215591_at 23314 SATB2 AK02512 281.19 495.35 379.61 281.19 543.96 282.09 0.52 211556_at 10982 MAPR AB01682 3.61 1.65 1.96 3.61 17.01 8.82 0.52 214751 at 90333 ZNF46 BE54104 267.41 308.40 303.11 267.41 610.48 316.98 0.52 207290_at 5362 PLXNA NM_0251 3.00 2.04 5.63 3.00 21.53 11.19 0.52 202011_at 7082 TJP1 NM_0032 31.56 14.89 16.59 31.56 59.10 30.72 0.52 214237_x_at 5074 PAWR A1760470 19.62 42.67 35.14 19.62 44.00 22.88 0.52 216319_at AK02268 7.52 1.90 7.57 7.52 29.75 15.50 0.52 216110_x_at AU14701 46.58 109.60 84.39 46.58 135.38 70.62 0.52 217604_at A1086530 90.69 91.95 104.00 90.69 210.65 109.92 0.52 216469 at 727867 LOC72 AL16320 1.33 5.73 11.38 1.33 25.81 13.48 0.52 207369_at Z97632 12.09 24.32 26.20 12.09 25.45 13.29 0.52 213907 at 9521 EEF1E N32257 32.45 38.59 42.42 32.45 50.17 26.23 0.52 222042_x_at 399664 RKHD1 BF05653 11.91 8.76 12.25 11.91 23.85 12.47 0.52 208605_s_at 4914 NTRK1 NM_0025 3.05 6.12 1.55 3.05 74.43 38.94 0.52 214661_s_at 8602 C4orf9 R06783 831.88 560.56 779.27 831.88 1279.38 669.46 0.52 221038_at NM_0186 29.15 46.72 39.31 29.15 64.99 34.09 0.52 205030_at 2173 FABP7 NM_0014 7.56 9.22 19.31 7.56 27.41 14.38 0.52 210673 x at 7080 TITF1 D50740 12.40 10.73 8.65 12.40 19.09 10.02 0.52 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 209764_at AL02231 24.66 24.31 17.34 24.66 41.41 21.79 0.53 204481_at 7862 BRPF1 NM_0046 624.18 645.33 571.52 624.18 995.56 524.54 0.53 204244sat 10926 DBF4 NM0067 777.92 754.74 1146.76 777.92 1236.63 651.74 0.53 212804_s_at 26130 GAPV A1797397 625.29 624.61 590.20 625.29 1050.10 553.71 0.53 215213 at 53371 NUP54 AU14694 10.37 28.70 26.00 10.37 26.43 13.94 0.53 207043_s_at 6536 SLC6A NM_0069 25.77 30.65 45.00 25.77 39.89 21.05 0.53 206087_x_at 3077 HFE NM_0004 23.96 30.90 25.87 23.96 49.91 26.35 0.53 204885_s_at 10232 MSLN NM_0058 5.85 4.68 9.92 5.85 15.39 8.13 0.53 208843_s_at 26003 GORA BO00140 1166.36 913.23 1102.22 1166.36 2140.69 1130.79 0.53 213515xat 3047 /// HBG1 A1133353 7.55 17.08 17.43 7.55 14.75 7.81 0.53 219698_s_at 64863 METTL NM_0228 229.77 268.51 217.64 229.77 357.49 189.32 0.53 212646_at 23180 RFTN1 D42043 598.16 797.78 1154.46 598.16 2992.35 1590.21 0.53 201519_at 9868 TOMM NM_0148 1139.68 1130.48 1445.11 1139.68 2462.65 1309.62 0.53 203185 at 9770 RASSF NM0147 918.83 1236.44 624.67 918.83 1444.26 768.21 0.53 206083_at 575 BAIL NM_0017 5.80 15.93 12.27 5.80 15.98 8.50 0.53 210050_at 7167 TPI1 M10036 37.52 52.62 69.45 37.52 60.98 32.47 0.53 212606_at 23001 WDFY AL53631 641.82 875.31 829.18 641.82 1007.42 536.39 0.53 201542_at 56681 SAR1A AY00826 723.66 797.87 823.10 723.66 1172.98 625.20 0.53 216162_at 55206 SBNO1 AK02412 5.34 3.04 22.00 5.34 38.42 20.52 0.53 213351 s at 23023 TMCC1 AB01832 165.36 179.59 174.97 165.36 319.85 171.06 0.53 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 213567_at BF43196 551.09 504.28 556.12 551.09 1373.65 735.42 0.54 213409_s_at 6009 RHEB BF59372 67.27 60.90 98.52 67.27 125.95 67.43 0.54 205217_at 1678 TIMM8 NM_0040 126.84 90.15 96.93 126.84 194.50 104.30 0.54 219053_s_at 55048 VPS37 NM_0179 1198.05 1276.55 1540.24 1198.05 2476.83 1329.01 0.54 213637 at BE50339 438.11 436.35 477.85 438.11 937.19 503.07 0.54 218707_at 55311 ZNF44 NM 0183 91.95 95.72 117.76 91.95 179.84 96.70 0.54 204010_s_at 3845 KRAS NM_0049 33.72 33.88 43.86 33.72 50.86 27.38 0.54 213165_at 9857 CEP350 A1041204 1539.30 1494.91 1673.92 1539.30 2332.14 1255.70 0.54 213560_at 4616 GADD AV65868 11.79 35.24 58.52 11.79 107.99 58.20 0.54 206235_at 3981 LIG4 NM_0023 117.38 160.36 118.74 117.38 222.17 119.80 0.54 AFFX-r2-Bs- AFFX-r2- 2.24 8.15 3.04 2.24 18.75 10.11 0.54 lys-3_at Bs-lys-3 205825_at 5122 PCSK1 NM_0004 7.09 9.22 8.50 7.09 17.48 9.43 0.54 208135_at 6928 TCF2 NM_0064 5.83 9.21 10.04 5.83 17.97 9.70 0.54 202445_s_at 4853 NOTC NM_0244 92.07 118.35 84.60 92.07 181.68 98.05 0.54 209945_s_at 2932 GSK3B BO00025 490.15 495.20 559.85 490.15 803.29 433.67 0.54 203347_s_at 22823 MTF2 NM_0073 599.35 632.99 579.21 599.35 1402.04 757.01 0.54 209422_at 51230 PHF20 AY02752 1019.85 1234.74 1533.52 1019.85 2319.53 1254.73 0.54 219146_at 79736 C17orf4 NM0246 542.17 645.81 600.70 542.17 959.75 519.55 0.54 202435sat 1545 CYP1B AU15450 624.04 857.21 318.42 624.04 1683.84 912.77 0.54 201997 s at 23013 SPEN NM 0150 1294.84 1381.87 1278.71 1294.84 2117.06 1147.92 0.54 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 207935_s_at 3860 KRT13 NM_0022 3.38 1.85 6.36 3.38 11.03 5.99 0.54 209957sat 4878 NPPA M30262 23.43 34.34 31.17 23.43 79.99 43.45 0.54 212176 at 25957 C6orfll AA90232 1542.05 1485.49 1514.14 1542.05 2351.72 1277.42 0.54 214957_at 81569 ACTL8 BF59445 6.95 8.16 27.85 6.95 16.82 9.15 0.54 212090_at 2907 GRINA AL57142 908.66 1500.60 1270.25 908.66 1519.22 826.93 0.54 207476 at 50618 ITSN2 NM 0185 7.50 4.27 8.31 7.50 18.44 10.04 0.54 212435_at 51592 TRIM3 AA20559 565.79 554.14 538.25 565.79 878.07 478.06 0.54 218170 at 51015 ISOC1 NM 0160 609.14 797.72 811.27 609.14 1734.46 944.32 0.54 221917_s_at 2926 GRSF1 BF05846 46.94 42.56 48.07 46.94 72.49 39.50 0.54 216884 at 5782 PTPN1 S69182 7.44 12.68 36.09 7.44 91.33 49.77 0.54 218757_s_at 65109 UPF3B NM_0230 646.34 759.28 895.07 646.34 1205.29 657.07 0.55 203346sat 22823 MTF2 AF07281 1463.65 1632.74 1331.98 1463.65 2687.47 1465.67 0.55 210495_x_at 2335 FN1 AF13009 17.03 59.51 49.75 17.03 99.64 54.35 0.55 214744_s_at 9349 RPL23 AK02196 73.88 116.48 94.19 73.88 161.75 88.25 0.55 221870_at 30846 EHD2 A1417917 21.04 29.86 12.01 21.04 129.40 70.60 0.55 204073_s_at 745 Cllorf9 NM_0132 32.85 39.30 32.69 32.85 51.60 28.16 0.55 206386_at 6906 SERPI NM_0003 5.41 19.84 21.03 5.41 19.51 10.65 0.55 212888_at 23405 DICER BG10974 532.23 608.67 501.68 532.23 798.74 436.21 0.55 211168_s_at 5976 UPF1 D86988 503.32 554.73 450.32 503.32 925.90 506.53 0.55 210542_s_at 28232 SLCO3 BO00058 57.56 64.09 50.14 57.56 122.36 66.97 0.55 Al 5 208298 at EE 7813 EVIS NM 0056 7.93 3.06 2.90 7.93 12.68 6.95 0.55 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 44822_s_at 54531 MIER2 AW00388 192.34 196.07 136.93 192.34 295.84 162.46 0.55 204686_at 3667 IRS1 NM 0055 41.93 50.71 16.99 41.93 131.26 72.11 0.55 211678_s_at 55905 ZNF31 AF09093 1296.20 1152.15 1341.12 1296.20 2414.30 1326.73 0.55 219567_s_at 64789 Clorfl7 NM_0227 936.37 1313.36 1059.32 936.37 1463.09 804.25 0.55 210155 at 4653 MYOC D88214 48.84 49.97 42.84 48.84 74.98 41.22 0.55 219448_at 54968 TMEM BC00274 65.56 57.68 70.05 65.56 136.50 75.08 0.55 213457_at 9258 MFHA BF73995 620.68 643.62 571.84 620.68 1174.55 646.13 0.55 213544 at 3622 ING2 A1186701 22.40 14.76 35.39 22.40 64.74 35.62 0.55 219624_at 9530 BAG4 NM_0048 130.48 128.96 142.46 130.48 202.16 111.28 0.55 214718 at 57798 GATA AK02614 421.81 467.90 544.32 421.81 788.14 434.36 0.55 218783 at 25896 INTS7 AL13304 307.52 316.47 258.88 307.52 474.68 261.64 0.55 203575 at 1459 CSNK2 NM0018 402.45 415.51 340.72 402.45 803.90 443.29 0.55 206164_at 9635 CLCA2 NM_0065 5.90 7.51 3.32 5.90 11.06 6.10 0.55 202073 at 10133 OPTN AV75767 173.40 450.81 407.47 173.40 441.30 243.39 0.55 215128 at AV70423 116.39 162.95 132.27 116.39 285.39 157.51 0.55 208287_at 10255 HCG9 NM_0058 11.72 6.94 23.96 11.72 22.89 12.63 0.55 207815_at 5197 PF4V1 NM_0026 3.99 18.84 17.84 3.99 23.36 12.91 0.55 201794sat 9887 SMG7 NM0148 858.91 791.45 990.44 858.91 1352.73 748.10 0.55 215457_at 10552 ARPC1 AF07064 23.57 4.00 31.40 23.57 39.62 21.94 0.55 213734 at BG26065 374.34 370.20 554.06 374.34 962.96 533.48 0.55 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 204909_at 1656 DDX6 NM_0043 63.64 81.28 63.34 63.64 100.97 55.96 0.55 202565_s_at 6840 SVIL NM 0031 141.61 96.43 148.47 141.61 357.23 198.04 0.55 220651_s_at 55388 MCM1 AB04271 261.54 280.33 216.37 261.54 412.86 228.91 0.55 213500_at 9276 COPB2 A1307760 217.20 244.58 156.09 217.20 330.78 183.41 0.55 209558_s_at 728014 HIP1R AB01338 24.53 51.29 43.98 24.53 73.28 40.67 0.56 216504_s_at 64116 SLC39 AL04996 48.40 78.75 62.89 48.40 166.93 92.66 0.56 206208_at 762 CA4 NM_0007 5.51 24.52 18.78 5.51 10.62 5.90 0.56 216142 at AL13740 44.77 60.59 56.74 44.77 82.88 46.06 0.56 209120_at 7026 NR2F2 AL03740 29.67 56.19 56.29 29.67 106.88 59.45 0.56 202230_s_at 10523 CHERP NM_0063 1955.62 1567.98 1532.63 1955.62 3126.88 1739.84 0.56 205335_s_at 6728 SRP19 NM_0031 2107.55 2076.69 2037.09 2107.55 3826.84 2132.52 0.56 204533_at 3627 CXCL1 NM_0015 12.53 3433.73 4050.06 12.53 1996.92 1112.92 0.56 219719_at 51751 HIGD1 NM_0164 7.60 10.61 8.46 7.60 15.40 8.59 0.56 201110_s_at 7057 THBS1 NM_0032 2.69 49.97 64.93 2.69 644.40 359.39 0.56 217400_at 392454 LOC39 AL03441 12.30 4.15 9.35 12.30 19.04 10.64 0.56 202295_s_at 1512 CTSH NM_0043 3602.55 5815.13 4593.58 3602.55 6007.85 3361.13 0.56 222107_x_at 11178 LZTS1 BE31298 8.73 37.20 35.80 8.73 30.31 16.96 0.56 214133_at 4588 MUC6 A1611214 16.68 36.64 51.79 16.68 64.05 35.85 0.56 216725_at 166614 DCAM AL35960 5.30 5.23 3.99 5.30 10.41 5.83 0.56 210383_at 6323 SCN1A AF22598 5.32 9.15 8.31 5.32 12.37 6.93 0.56 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 214860_at 84679 SLC9A AL02216 5.63 8.81 3.45 5.63 12.57 7.04 0.56 204812_at 9183 ZW10 NM_0047 383.66 380.50 389.53 383.66 588.00 329.62 0.56 205709_s_at 1040 CDS1 U65887 125.58 113.83 107.86 125.58 209.70 117.59 0.56 210419_at 8538 BARX2 AF03192 9.57 14.74 16.75 9.57 19.18 10.77 0.56 220886_at 55879 GABR NM_0185 16.38 2.86 6.70 16.38 28.47 16.00 0.56 218956_s_at 26024 PTCD1 NM_0155 270.00 270.28 268.69 270.00 575.45 323.52 0.56 201667_at 2697 GJA1 NM_0001 2.13 20.51 15.90 2.13 102.85 57.84 0.56 203358_s_at 2146 EZH2 NM 0044 1011.21 1048.92 1116.89 1011.21 2182.16 1227.15 0.56 217828_at 79811 SLTM NM_0247 1018.28 888.35 884.24 1018.28 1653.10 930.70 0.56 203066_at 51363 GALN NM_0148 11.67 6.84 24.21 11.67 24.13 13.60 0.56 208016_s_at 185 AGTR1 NM_0048 6.06 7.07 15.78 6.06 10.77 6.07 0.56 209705_at BG03376 615.53 648.43 718.05 615.53 1163.32 655.88 0.56 221982_x_at 8270 LAGE3 AA03449 12.66 7.30 6.93 12.66 21.49 12.13 0.56 213076_at 80271 ITPKC D38169 72.56 81.20 98.58 72.56 121.95 68.86 0.56 220939_s_at 54878 DPP8 NM_0177 1150.90 1296.89 1132.00 1150.90 1771.65 1000.55 0.56 220121_at 55180 LINS1 NM_0181 80.59 84.47 92.25 80.59 143.84 81.29 0.57 215092_s_at 10725 NFATS AJ005683 126.73 287.38 240.81 126.73 611.89 345.88 0.57 201934_at 80335 TMEM N92524 1911.34 1566.53 1812.90 1911.34 4097.14 2317.02 0.57 203038_at 5796 PTPRK NM_0028 534.39 648.97 742.03 534.39 1149.32 650.04 0.57 216655 s at AF04181 4.20 5.23 3.73 4.20 21.65 12.24 0.57 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 218447_at 56942 C16orf6 NM_0201 815.60 958.90 934.89 815.60 1911.90 1081.77 0.57 216336_x_at 4499 MT1M AL03160 771.07 469.15 498.68 771.07 1218.16 689.54 0.57 221169_s_at 59340 HRH4 AF31223 6.60 13.81 16.80 6.60 13.76 7.79 0.57 221168_at 59336 PRDM1 NM_0216 26.10 33.88 25.79 26.10 57.25 32.44 0.57 222047_s_at 51593 ARS2 A1523895 3175.02 3036.78 2857.66 3175.02 4881.85 2767.32 0.57 201558_at 8480 RAE1 NM_0036 1308.92 1246.68 1264.18 1308.92 2214.87 1256.22 0.57 216814_at AL35358 6.18 15.59 30.87 6.18 22.78 12.94 0.57 204176 at 27252 KLHL2 AA80869 171.63 221.34 206.44 171.63 258.85 147.07 0.57 37152_at 5467 PPARD L07592 816.89 1283.54 1017.45 816.89 1808.92 1027.89 0.57 209115_at 9039 UBE1C AL11756 1143.90 1476.21 1511.58 1143.90 2027.89 1152.50 0.57 201109_s_at 7057 THBS1 AV72667 8.37 54.04 71.48 8.37 585.69 332.94 0.57 213673xat 29937 NENF AA15625 23.67 12.40 64.29 23.67 56.48 32.14 0.57 202429_s_at 5530 PPP3C AL35395 2546.81 2925.70 2581.92 2546.81 4408.70 2510.26 0.57 214743_at 1523 CUTL1 BE04652 517.17 815.05 750.95 517.17 1328.98 756.84 0.57 214175_x_at 8572 PDLIM A1254547 111.09 132.61 106.52 111.09 1380.21 786.14 0.57 203255_at 80204 FBXO1 NM_0186 467.30 553.26 512.44 467.30 1039.36 593.22 0.57 200995_at 10527 1PO7 A1741392 898.97 728.95 761.91 898.97 1456.93 831.65 0.57 201678_s_at 56941 C3orf37 A1937543 294.64 327.53 346.71 294.64 538.95 307.69 0.57 220203_at 353500 BMP8A NM_0247 11.78 7.99 13.24 11.78 24.62 14.06 0.57 203963 at 771 CA12 NM 0012 30.62 37.85 27.85 30.62 70.78 40.44 0.57 210068_s_at 361 AQP4 U63622 2.55 3.55 6.04 2.55 11.20 6.40 0.57 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 219801_at 80778 ZNF34 NM_0305 105.12 90.95 82.85 105.12 161.75 92.45 0.57 210500_at BO00195 9.70 27.09 31.23 9.70 26.52 15.17 0.57 206207_at 1178 CLC NM_0018 4.34 5.02 2.67 4.34 10.98 6.28 0.57 211221_at 10474 TADA3 AL11748 14.41 28.17 41.59 14.41 21.97 12.57 0.57 218888_s_at 81831 NETO2 A1335263 620.42 694.17 411.07 620.42 1162.49 665.59 0.57 205962_at 5062 PAK2 NM_0025 5.10 6.52 4.52 5.10 10.55 6.04 0.57 209005_at 26234 FBXL5 AF15732 402.10 489.15 494.98 402.10 611.07 350.09 0.57 221506_s_at 30000 TNPO2 BG25863 523.21 581.43 517.79 523.21 926.33 531.48 0.57 221654_s_at 9960 USP3 AF07704 1046.89 1022.30 1404.66 1046.89 2334.51 1339.48 0.57 216170_at 1937 EEF1G AK02527 62.43 129.40 107.42 62.43 158.64 91.09 0.57 205016_at 7039 TGFA NM_0032 31.45 26.63 46.20 31.45 72.23 41.52 0.57 218939_at 3954 LETM1 NM_0123 61.30 48.56 97.44 61.30 104.34 60.07 0.58 211071_s_at 10962 MLLT1 BC00647 80.14 87.38 86.95 80.14 159.72 92.03 0.58 205525_at 800 CALD1 NM_0184 20.67 18.24 25.10 20.67 36.63 21.13 0.58 204449_at 5082 PDCL NM_0053 214.13 210.87 480.31 214.13 345.82 199.64 0.58 218833_at 51776 ZAK NM_0166 81.01 82.76 82.80 81.01 134.45 77.67 0.58 203355_s_at 23362 PSD3 NM_0153 507.92 624.18 948.42 507.92 3142.40 1815.89 0.58 203481_at 55719 ClOorf6 A1655902 235.56 196.06 205.55 235.56 392.47 227.09 0.58 215363_x_at 2346 FOLH1 AW16891 19.13 19.05 11.89 19.13 44.97 26.04 0.58 204620 s at 1462 CSPG2 NM_0043 272.63 479.87 383.43 272.63 597.02 345.69 0.58 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 204926_at 3624 INHBA NM_0021 15.48 7.96 1.44 15.48 27.03 15.67 0.58 211339_s_at 3702 ITK D13720 17.30 11.10 13.78 17.30 27.76 16.10 0.58 213122_at 85453 TSPYL A1096375 891.44 626.71 650.82 891.44 1365.32 792.27 0.58 212412_at 10611 PDLIM AV71576 1104.80 1587.77 1280.50 1104.80 1993.22 1157.15 0.58 221974_at 63968 PWCR1 AW77074 163.05 222.80 210.50 163.05 267.26 155.19 0.58 215045_at 11189 TNRC4 BC00414 6.94 7.96 11.89 6.94 18.72 10.87 0.58 210047 at 4891 SLC11 AF06448 25.04 12.54 34.35 25.04 105.56 61.33 0.58 202457sat 5530 PPP3C AA91123 1878.67 2067.17 1969.82 1878.67 3811.17 2214.15 0.58 218859_s_at 51575 ESF1 NM_0166 405.27 316.59 411.38 405.27 687.15 399.25 0.58 219792_at 79814 AGMA NM0247 17.48 32.52 33.58 17.48 48.63 28.26 0.58 218279_s_at 8337 HIST2 BC00162 29.81 72.00 54.01 29.81 94.79 55.10 0.58 221569_at 54806 AHI1 AL13679 258.34 338.49 282.42 258.34 546.72 317.96 0.58 203673_at 7038 TG NM_0032 38.30 31.98 10.90 38.30 115.66 67.27 0.58 202655_at 7873 ARME NM 0060 1387.14 2019.70 1247.65 1387.14 2130.75 1239.48 0.58 201566_x_at 3398 /// ID2 NM_0021 383.92 461.04 156.05 383.92 1336.35 777.63 0.58 215750_at 85373 KIAA1 AB05144 86.88 114.23 125.76 86.88 132.43 77.08 0.58 202843_at 4189 DNAJB NM_0123 56.63 74.98 149.09 56.63 366.95 214.10 0.58 221729_at 1290 COLSA AL57573 20.18 11.28 22.13 20.18 307.15 179.24 0.58 217947_at 54918 CMTM NM0178 5067.56 5746.33 5613.70 5067.56 7918.64 4621.34 0.58 222308_x_at 9984 THOC1 AV70040 17.44 13.13 9.93 17.44 34.68 20.25 0.58 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 218649_x_at 9147 SDCCA NM_0047 690.20 739.86 832.53 690.20 1344.82 785.54 0.58 204204_at 1318 SLC31 NM_0018 69.78 160.89 124.61 69.78 269.65 157.60 0.58 220765sat 55679 LIMS2 NM 0179 104.77 130.97 110.48 104.77 454.49 265.64 0.58 208816xat 304 ANXA M62898 1277.14 1657.98 1732.89 1277.14 2493.57 1457.84 0.58 209704_at AL52338 411.75 465.01 465.04 411.75 939.24 549.57 0.59 213044_at 6093 ROCK1 N22548 2153.60 2018.87 2398.84 2153.60 3533.11 2068.97 0.59 206652_at 9205 ZMYM NM_0163 107.50 145.22 182.96 107.50 215.98 126.50 0.59 32032_at 8220 DGCR1 L77566 491.02 466.07 592.26 491.02 865.24 507.43 0.59 217464_at L48784 27.50 40.30 21.12 27.50 49.38 28.96 0.59 220520_s_at 54830 NUP62 NM_0176 3.38 2.63 10.86 3.38 10.11 5.93 0.59 203476 at 7162 TPBG NM 0066 1547.74 1859.00 1448.97 1547.74 2461.87 1445.51 0.59 217992_s_at 79180 EFHD2 AW66417 2087.89 2742.68 1521.53 2087.89 4132.64 2427.90 0.59 216357_at 6642 SNX1 AL05014 3.46 11.61 25.37 3.46 13.89 8.16 0.59 207058_s_at 5071 PARK2 NM_0045 20.26 30.54 37.07 20.26 34.28 20.16 0.59 220962_s_at 29943 PADI1 NM_0133 28.98 76.92 62.85 28.98 94.95 55.88 0.59 204042_at 10810 WASF3 AB02070 8.08 8.35 9.49 8.08 16.34 9.62 0.59 219290_x_at 27071 DAPP1 NM_0143 699.32 1441.05 1434.34 699.32 1269.02 747.23 0.59 201054_at 10949 HNRP BE96659 2367.56 2412.44 1967.07 2367.56 3839.74 2262.69 0.59 219902_at 23743 BHMT NM_0176 9.25 12.98 8.28 9.25 14.57 8.59 0.59 209161_at 9128 PRPF4 A1184802 1263.94 1229.26 1127.79 1263.94 2497.99 1475.02 0.59 205664 at 22944 KIN NM 0123 223.92 193.14 225.06 223.92 341.81 201.90 0.59 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 219049_at 55790 ChGn NM_0183 38.51 26.81 31.40 38.51 197.61 116.77 0.59 212989_at 259230 TMEM A1377497 31.60 40.87 45.39 31.60 54.14 32.00 0.59 219747 at 79625 C4orf3l NM0245 44.69 44.20 55.00 44.69 124.89 73.81 0.59 206442_at 6406 SEMG1 NM_0030 78.87 70.34 69.75 78.87 163.27 96.60 0.59 212522 at 5151 PDE8A W73272 123.91 182.94 229.48 123.91 584.71 346.00 0.59 207279_s_at 10529 NEBL NM_0163 12.47 19.33 16.29 12.47 38.60 22.85 0.59 203562_at 9638 FEZ1 NM_0051 274.24 1270.93 1430.17 274.24 3040.29 1800.35 0.59 218358_at 8812 CCNK NM_0243 2082.26 2626.58 1781.27 2082.26 3180.78 1883.74 0.59 203620_s_at 9873 FCHSD NM_0148 351.87 398.56 367.25 351.87 597.74 354.69 0.59 206028_s_at 10461 MERT NM_0063 39.27 43.70 41.43 39.27 67.32 39.95 0.59 202660_at 3709 ITPR2 AA83457 66.59 98.91 79.22 66.59 131.94 78.37 0.59 218131_s_at 54815 GATA AK02467 568.29 661.47 600.94 568.29 1127.27 670.07 0.59 205946_at 7434 VIPR2 NM_0033 6.03 8.98 25.12 6.03 13.15 7.81 0.59 222106_at 23627 PRND AL13339 4.92 8.82 26.67 4.92 20.22 12.03 0.59 208462_s_at 10060 ABCC9 NM_0056 13.41 11.27 7.50 13.41 22.00 13.09 0.60 205527_s_at 50628 GEMIN NM_0154 175.68 183.32 140.97 175.68 350.20 208.47 0.60 220476_s_at 55924 Clorfl8 NM_0190 24.14 12.49 25.01 24.14 49.36 29.39 0.60 209296_at 5495 PPM1B AF13697 1521.64 1397.15 1972.36 1521.64 2494.04 1485.51 0.60 210335_at 9182 PAMCI AF05620 10.06 7.72 21.71 10.06 19.88 11.84 0.60 212972 x at AL08013 16.33 30.31 39.88 16.33 29.54 17.63 0.60 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 203898_at 27297 RCP9 AU15485 153.56 181.76 191.90 153.56 294.30 175.82 0.60 207812_s_at 26003 GORA NM_0155 1356.37 1316.83 1221.07 1356.37 2195.98 1312.22 0.60 212643 at 93487 C14orf3 A1671747 3791.63 3457.95 3260.05 3791.63 6364.90 3803.72 0.60 204296_at 1639 DCTN1 NM_0211 28.07 28.90 59.15 28.07 62.64 37.49 0.60 203419_at 9757 MLL4 NM_0147 306.37 458.27 260.17 306.37 500.38 299.54 0.60 204655 at 6352 CCL5 NM 0029 1774.54 2421.70 2736.70 1774.54 13645.23 8170.20 0.60 205255_x_at 6932 TCF7 NM_0032 279.46 339.40 216.17 279.46 540.90 323.87 0.60 219743_at 23493 HEY2 NM_0122 3.36 7.80 6.20 3.36 11.12 6.67 0.60 219128_at 54980 C2orf42 NM_0178 198.95 205.65 231.04 198.95 327.95 196.67 0.60 211149_at 7404 UTY AF00099 69.65 100.26 99.90 69.65 131.54 78.95 0.60 212726_at 5253 PHF2 AB01456 500.61 479.08 465.57 500.61 793.54 477.15 0.60 216731_s_at 389768 LOC38 AK02369 3.28 4.84 2.50 3.28 12.82 7.71 0.60 213275_x_at 1508 CTSB W47179 658.11 663.52 549.73 658.11 1041.07 626.45 0.60 220667_at NM_0185 11.65 7.88 23.12 11.65 24.81 14.95 0.60 217579_x_at 64225 ARL6I AW30180 210.96 165.28 403.77 210.96 375.05 226.03 0.60 220895_at 57663 USP29 NM_0209 10.72 7.70 6.64 10.72 16.14 9.73 0.60 222270_at 57223 SMEK2 BG54004 27.47 48.27 47.65 27.47 70.22 42.33 0.60 213479_at 4885 NPTX2 U26662 259.79 365.58 240.72 259.79 1620.57 977.75 0.60 218984 at 54517 PUS7 NM 0190 533.43 367.17 404.26 533.43 1091.49 658.54 0.60 221680 s at 51513 ETV7 AF14778 25.25 47.37 37.06 25.25 57.60 34.77 0.60 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 215454_x_at 6440 SFTPC A1831055 8.18 5.80 6.03 8.18 13.10 7.91 0.60 219441_s_at 79705 LRRK1 NM_0246 123.60 100.35 116.42 123.60 232.30 140.48 0.60 212846_at 23076 KIAAO AA81119 1082.23 830.79 848.05 1082.23 1756.32 1062.20 0.60 203345_s_at 22823 MTF2 A1566096 2207.34 2366.26 2104.05 2207.34 3740.22 2265.45 0.61 212083_at 113419 TEX26 AV75955 836.12 751.67 794.43 836.12 1282.77 777.36 0.61 221244_s_at NM 0312 44.60 46.48 48.65 44.60 67.31 40.81 0.61 206878_at 1610 DAO NM_0019 20.21 38.40 31.06 20.21 36.77 22.31 0.61 220323_at 79935 CNTD2 NM_0248 54.39 87.58 77.82 54.39 83.78 50.84 0.61 201594_s_at 9989 PPP4R1 NM_0051 761.99 1024.43 802.41 761.99 1481.98 899.34 0.61 203464_s_at 22905 EPN2 NM_0149 57.63 91.85 72.60 57.63 95.79 58.14 0.61 204493_at 637 BID NM_0011 382.02 933.59 809.83 382.02 2783.34 1690.01 0.61 207844_at 3596 IL13 NM0021 24.38 46.53 40.21 24.38 45.47 27.61 0.61 219531_at 55722 CEP72 NM_0181 167.53 173.60 200.58 167.53 300.73 182.67 0.61 214706_at 7752 ZNF20 AU14944 376.85 445.79 419.95 376.85 651.74 395.92 0.61 220961_s_at 9238 TBRG4 NM_0309 102.97 124.95 97.25 102.97 224.01 136.09 0.61 216247_at AF11300 40.65 59.63 25.48 40.65 80.87 49.13 0.61 217757_at 2 A2M NM_0000 71.81 69.95 64.21 71.81 113.55 69.01 0.61 205150sat 9865 KIAAO AV72419 14.91 17.40 14.12 14.91 31.84 19.36 0.61 212940_at 1291 COL6A BE35014 18.11 25.09 35.21 18.11 52.97 32.20 0.61 207860_at 9437 NCR1 NM_0048 3.17 3.24 1.89 3.17 10.70 6.50 0.61 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 209459_s_at 18 ABAT AF23781 140.40 75.56 98.52 140.40 519.06 315.70 0.61 221552_at 57406 ABHD6 BC00169 93.69 117.93 165.66 93.69 263.25 160.35 0.61 212458_at 200734 SPRED H97931 831.60 1203.64 1317.60 831.60 4278.55 2607.09 0.61 211445xat 389240 NACA AF31595 5704.31 6411.03 9891.98 5704.31 9755.78 5944.85 0.61 200673 at 9741 LAPT NM0147 1716.40 1531.08 1677.57 1716.40 2675.01 1630.72 0.61 217897_at 53826 FXYD6 NM_0220 69.25 36.73 48.36 69.25 209.49 127.73 0.61 206239_s_at 6690 SPINK NM_0031 9.50 14.67 21.22 9.50 20.58 12.55 0.61 217574_at 1006 CDH8 T65123 2.00 7.87 15.49 2.00 32.22 19.66 0.61 214841 at 149111 CNIH3 AF07052 35.88 5.37 41.10 35.88 154.61 94.40 0.61 206712_at 79774 GRTP1 NM_0247 5.53 6.30 11.56 5.53 11.69 7.14 0.61 217618_x_at 3364 HUS1 AW00798 133.90 130.20 136.67 133.90 243.64 148.93 0.61 203840_at 8548 BLZF1 NM_0036 173.30 194.33 166.51 173.30 306.20 187.28 0.61 213037_x_at 6780 STAU1 AJ132258 2281.36 1958.66 2554.56 2281.36 3630.45 2220.53 0.61 218042_at 51138 COPS4 NM_0161 895.30 791.04 896.08 895.30 1469.97 899.50 0.61 205994_at 2005 ELK4 NM_0019 42.83 27.01 42.98 42.83 80.40 49.20 0.61 204653_at 7020 TFAP2 BF34300 62.25 352.23 341.09 62.25 1355.87 829.89 0.61 208780xat 9218 VAPA AF15484 5331.27 5276.47 6669.87 5331.27 9326.57 5712.03 0.61 215775_at 7057 THBS1 BF08410 8.33 41.92 44.68 8.33 45.12 27.64 0.61 207480_s_at 4212 MEIS2 NM_0201 327.69 256.31 279.73 327.69 1017.66 623.66 0.61 218236_s_at 23683 PRKD3 NM_0058 533.29 623.45 771.24 533.29 1030.95 633.16 0.61 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 207570_at 6473 SHOX NM_0004 3.25 7.56 7.05 3.25 26.59 16.33 0.61 211269_s_at 3559 IL2RA K03122 6.10 3.35 6.99 6.10 17.80 10.94 0.61 213732_at 6929 TCF3 A1871234 18.93 21.71 22.02 18.93 36.10 22.19 0.61 218819_at 26512 INTS6 NM_0121 904.26 1274.85 1041.84 904.26 1658.35 1019.46 0.61 202842_s_at 4189 DNAJB AL08008 396.07 479.83 595.35 396.07 1556.19 956.83 0.61 209430_at 9044 BTAF1 AJ001017 540.74 557.37 604.34 540.74 1010.70 621.56 0.61 217264_s_at 6337 SCNN1 U81961 4.44 11.93 14.34 4.44 18.99 11.69 0.62 A

216192_at 2173 FABP7 AL51268 8.19 10.96 6.39 8.19 38.90 23.95 0.62 209802_at 7262 PHLDA BC00503 33.05 20.28 26.10 33.05 61.38 37.81 0.62 202054_s_at 224 ALDH3 NM_0003 155.79 156.50 145.58 155.79 275.61 169.83 0.62 217371_s_at 3600 IL15 Y09908 13.08 18.82 18.19 13.08 32.69 20.15 0.62 218263_s_at 58486 ZBED5 NM 0212 1325.33 1337.89 1414.79 1325.33 2247.35 1388.28 0.62 216038_x_at 1616 DAXX BE96571 335.63 285.30 302.23 335.63 620.78 383.80 0.62 202720_at 26136 TES NM_0156 993.94 889.84 1123.07 993.94 1646.51 1018.15 0.62 204619_s_at 1462 CSPG2 BF59026 27.86 9.59 43.59 27.86 57.19 35.36 0.62 214314_s_at 9669 EIF5B BE13864 329.67 289.82 284.70 329.67 566.31 350.57 0.62 213352_at 23023 TMCC1 AB01832 106.92 161.57 137.23 106.92 214.45 132.80 0.62 219022_at 64897 C12orf4 NM0228 348.72 354.57 362.11 348.72 596.55 369.52 0.62 208469_s_at 80864 EGFL8 NM_0306 21.30 62.19 62.15 21.30 53.36 33.05 0.62 217550_at 22926 ATF6 AA57649 222.62 315.80 284.91 222.62 404.33 250.54 0.62 204722_at 55800 SCN3B AW00733 10.53 13.04 14.60 10.53 31.26 19.42 0.62 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 220996_s_at 81626 Clorfl4 NM_0309 7.22 4.00 4.45 7.22 12.89 8.01 0.62 206417_at 1259 CNGA1 NM_0000 23.28 12.07 32.35 23.28 46.24 28.75 0.62 204516_at 6314 ATXN7 BG39030 360.88 448.85 406.68 360.88 617.16 383.77 0.62 202255_s_at 26037 SIPAIL NM_0155 70.22 83.38 76.14 70.22 266.24 165.66 0.62 208948_s_at 6780 STAU1 BC00083 1935.73 1827.41 2306.62 1935.73 3498.32 2176.79 0.62 210135_s_at 6474 SHOX2 AF02265 3460.15 4612.13 4402.03 3460.15 8271.93 5147.53 0.62 216830_at 730909 LOC73 AC00446 3.44 7.04 7.39 3.44 14.18 8.82 0.62 200028_s_at 56910 STARD NM_0201 3322.02 3987.67 5578.30 3322.02 5058.23 3148.26 0.62 205173_x_at 965 CD58 NM_0017 1039.87 2046.09 2432.88 1039.87 2577.48 1604.72 0.62 200765xat 1495 CTNN NM 0019 1333.37 1579.45 1452.13 1333.37 2113.12 1315.90 0.62 Al 03 222063_s_at 1040 CDS1 A1991484 8.41 31.67 28.21 8.41 18.70 11.65 0.62 203556_at 22882 ZHX2 NM_0149 119.00 133.57 110.55 119.00 615.44 383.72 0.62 204349_at 9443 CRSP9 BO00525 180.17 139.89 326.86 180.17 333.79 208.15 0.62 209065_at 7381 UQCR BC00523 481.62 422.25 445.20 481.62 735.25 458.52 0.62 201352_at 10730 YME1L NM_0142 1525.93 1264.93 1815.25 1525.93 2877.65 1796.07 0.62 215011_at 8420 SNHG3 AJ006835 60.04 75.78 38.54 60.04 139.09 86.90 0.62 218050_at 51569 UFM1 NM_0166 692.72 719.87 1187.22 692.72 2208.74 1380.11 0.62 216132_at 23245 ASTN2 AK02199 6.29 18.19 20.26 6.29 10.28 6.43 0.63 209798_at 4863 NPAT D83243 320.67 306.07 351.91 320.67 498.47 312.15 0.63 221193_s_at 54819 ZCCHC NM_0176 463.67 457.06 544.79 463.67 1000.85 626.77 0.63 205103 at 10485 Clorf6l NM 0063 73.74 102.20 65.12 73.74 154.86 97.00 0.63 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 218677_at 57402 S100A1 NM 0206 13.70 17.72 27.49 13.70 36.21 22.69 0.63 204593_s_at 54471 SMCR7 AA04675 621.68 593.59 607.69 621.68 1025.19 642.44 0.63 220966_x_at 81873 ARPC5 NM_0309 1914.80 2009.32 2351.08 1914.80 2981.97 1868.80 0.63 219844_at 55088 CIOorfl NM_0180 20.21 30.40 25.63 20.21 32.29 20.25 0.63 205437_at 10520 ZNF21 NM_0063 235.16 313.25 289.22 235.16 466.66 292.72 0.63 216086_at 22987 SV2C AB02897 29.52 16.62 29.61 29.52 100.11 62.81 0.63 219540 at 10308 ZNF26 NM 0034 514.71 544.69 753.59 514.71 1470.33 922.84 0.63 201190_s_at 5306 PITPN H15647 429.23 572.34 461.82 429.23 1791.54 1125.31 0.63 A

216113_at 10152 AB12 AF07056 17.41 10.75 15.16 17.41 27.82 17.48 0.63 213359_at 3184 HNRP W74620 554.16 734.55 636.69 554.16 1436.56 902.80 0.63 D

46323_at 124583 CANT1 AL12074 792.96 791.03 798.35 792.96 1373.99 863.60 0.63 202365_at 84747 MGC51 BC00481 914.38 872.52 937.04 914.38 1446.69 909.35 0.63 215810_x_at 667 DST AL04921 11.98 25.79 46.93 11.98 60.62 38.13 0.63 45653_at 253980 KCTD1 AW02648 289.71 276.32 362.53 289.71 440.68 277.48 0.63 1405 i at 6352 CCLS M21121 1821.38 2494.79 2775.85 1821.38 13200.54 8314.36 0.63 202193_at 3985 LIMK2 NM_0055 197.52 265.61 274.95 197.52 417.67 263.27 0.63 203812_at AB01153 26.86 58.74 62.88 26.86 64.33 40.57 0.63 215086_at 25998 IBTK AB03783 30.19 36.89 51.24 30.19 51.15 32.27 0.63 213222_at 23236 PLCB1 AL04959 80.40 73.11 121.00 80.40 132.89 83.86 0.63 221741s at 54915 YTHDF AL09682 1411.69 1390.49 1433.95 1411.69 2711.22 1711.48 0.63 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 217921_at BE54306 190.20 195.75 162.92 190.20 389.90 246.42 0.63 210702_s_at 5740 PTGIS D38145 6.39 5.00 1.54 6.39 13.11 8.29 0.63 205854_at 7289 TULP3 AK02424 167.54 248.46 286.62 167.54 362.71 229.74 0.63 206670sat 253782 GAD1 NM 0134 4.24 5.43 4.17 4.24 10.29 6.52 0.63 204780_s_at 355 FAS NM_0000 26.39 33.87 40.50 26.39 53.76 34.12 0.63 210636_at 5467 PPARD BC00271 26.93 69.25 56.95 26.93 52.71 33.46 0.63 211028_s_at 3795 KHK BC00623 18.42 19.93 16.58 18.42 30.64 19.46 0.64 204781_s_at 355 FAS NM_0000 16.62 35.30 29.61 16.62 31.02 19.73 0.64 208841_s_at 9908 G3BP2 AB01456 1452.94 1479.71 1338.12 1452.94 2487.86 1582.42 0.64 205100_at 9945 GFPT2 NM_0051 24.06 34.37 31.69 24.06 190.76 121.38 0.64 217935_s_at 55245 C20orf4 NM_0182 367.57 388.98 356.64 367.57 623.00 396.43 0.64 218313_s_at 51809 GALN NM_0174 685.51 813.24 616.16 685.51 1333.29 849.43 0.64 202723_s_at 2308 F0X01 AW11749 69.08 78.66 55.05 69.08 162.03 103.24 0.64 212599_at 26053 AUTS2 AK02529 19.64 20.60 25.17 19.64 40.25 25.65 0.64 221208_s_at 79684 Cllorf6 NM0246 132.94 188.70 173.23 132.94 294.70 187.84 0.64 216874_at 401014 DKFZp U80770 66.91 175.68 200.55 66.91 206.56 131.67 0.64 211210_x_at 4068 SH2D1 AF10053 5.43 7.71 5.37 5.43 19.02 12.14 0.64 202293_at 10274 STAG1 NM_0058 309.76 346.82 356.80 309.76 481.01 307.06 0.64 202271_at 23219 FBXO2 AB00795 1350.05 1452.41 1483.51 1350.05 2591.69 1654.61 0.64 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa TMAA TMAA Control LPS TMAA TMAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 216993_s_at 1302 COL11 U32169 67.02 84.79 72.25 67.02 106.06 67.73 0.64 204661_at 1043 CD52 NM_0018 579.06 587.07 457.80 579.06 972.91 621.71 0.64 203508_at 7133 TNFRS NM_0010 572.31 801.24 236.66 572.31 1149.71 735.84 0.64 203341 at 10153 CEBPZ NM 0057 1314.48 1239.38 1179.44 1314.48 2203.97 1411.09 0.64 201983_s_at 1956 EGFR NM_0052 12.28 24.96 27.80 12.28 34.35 22.00 0.64 202987_at 10758 TRAF3 NM_0155 21.83 10.52 29.84 21.83 80.46 51.59 0.64 214581_x_at 27242 TNFRS BE56813 179.96 215.92 135.04 179.96 489.11 313.70 0.64 222048_at 157 ADRB AA53600 57.47 78.29 98.63 57.47 97.18 62.44 0.64 218851_s_at 55339 WDR33 NM_0183 69.73 77.84 112.19 69.73 128.53 82.68 0.64 209033_s_at 1859 DYRK1 D86550 2329.08 2284.34 3123.43 2329.08 3691.16 2377.82 0.64 A

209031_at 23705 IGSF4 AL51971 144.00 176.61 140.94 144.00 430.57 277.60 0.64 217767 at 653879 LOC65 NM0000 773.37 1495.52 1178.52 773.37 1752.15 1131.92 0.65 212950_at 221395 GPR11 BF94149 5.28 20.47 15.58 5.28 20.02 12.93 0.65 221538_s_at 5361 PLXNA T16388 186.40 295.26 224.93 186.40 687.09 444.55 0.65 219377 at 64762 FAM59 NM0227 133.94 155.88 209.60 133.94 218.04 141.17 0.65 205284_at 9816 KIAAO NM_0147 305.13 369.25 283.02 305.13 682.23 442.04 0.65 215289_at 388567 ZNF74 BE89269 2.08 17.62 16.87 2.08 18.09 11.73 0.65 213618_at 116984 CENTD AB01115 62.37 97.06 112.50 62.37 263.80 171.11 0.65 220623_s_at 80705 TSGA1 NM_0252 30.14 38.70 12.04 30.14 56.68 36.78 0.65 219848 sat 9668 ZNF43 NM 0146 194.30 141.73 254.84 194.30 311.26 202.01 0.65 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 213278_at 66036 MTMR AW01478 475.20 517.24 698.96 475.20 898.98 583.99 0.65 204529_s_at 9760 TOX A1961231 17.75 24.41 35.72 17.75 60.72 39.55 0.65 210946_at 8611 PPAP2 AF01440 97.48 130.98 203.41 97.48 195.26 127.21 0.65 204136_at 1294 COL7A NM_0000 60.72 55.28 78.62 60.72 162.49 105.89 0.65 218691_s_at 8572 PDLIM NM_0036 4.55 4.89 5.20 4.55 151.08 98.47 0.65 217544_at 729806 LOC72 AA76890 112.17 190.34 162.62 112.17 274.56 178.99 0.65 213861_s_at 25895 FAM11 N67741 215.39 202.33 158.00 215.39 351.94 229.48 0.65 45297_at 30846 EHD2 A1417917 95.74 87.00 71.45 95.74 144.40 94.16 0.65 213692_s_at 79053 ALG8 AA90425 3.89 3.57 4.70 3.89 20.32 13.26 0.65 200069_at 9733 SART3 A1656011 582.33 526.70 618.52 582.33 944.87 616.77 0.65 215067_x_at 7001 PRDX2 AU14794 198.01 368.59 300.37 198.01 329.30 215.14 0.65 204230_s_at 57030 SLC17 NM_0203 62.54 78.99 57.21 62.54 135.06 88.27 0.65 222197sat AF13181 4.96 8.77 15.30 4.96 11.17 7.31 0.65 202220_at 22889 KIAAO NM_0149 2158.94 3002.45 1957.96 2158.94 3789.31 2483.99 0.66 220270_at 56163 RNF17 NM_0190 7.77 3.66 5.55 7.77 19.52 12.80 0.66 214471_x_at 3972 LHB NM_0008 13.71 5.86 7.49 13.71 57.04 37.39 0.66 208660_at 1431 CS BC00010 2968.51 2552.89 2743.70 2968.51 5865.14 3845.51 0.66 214138_at 7633 ZNF79 AA28482 106.60 106.92 107.51 106.60 171.74 112.61 0.66 215087_at 56905 C15orf3 AL10973 95.46 110.41 121.80 95.46 174.64 114.62 0.66 213585 s at 5134 PDCD2 AA76498 30.02 58.73 53.27 30.02 59.62 39.17 0.66 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (10ng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (10ng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 823_at 6376 CX3CL U84487 5.74 7.30 22.08 5.74 48.30 31.74 0.66 220608_s_at NM_0141 36.90 44.48 59.57 36.90 90.25 59.31 0.66 205724_at 5317 PKP1 NM_0002 22.49 12.92 9.37 22.49 42.36 27.84 0.66 216693_x_at 50810 HDGF AL13310 21.71 47.74 39.87 21.71 52.67 34.62 0.66 214656xat 4641 MYO1 BE79015 173.29 327.17 269.11 173.29 412.61 271.33 0.66 215082_at 55000 // TUG1 BF97338 163.51 118.99 150.38 163.51 286.97 188.74 0.66 ELOVL

211764_s_at 7321 UBE2D BC00598 101.20 156.08 178.95 101.20 238.38 156.79 0.66 221062_at 9953 HS3ST NM_0060 10.40 8.33 4.04 10.40 49.34 32.46 0.66 213876_x_at 8233 ZRSR2 AW08958 288.13 421.13 376.38 288.13 456.03 300.00 0.66 40016_g at 23227 MAST4 AB00230 52.75 54.34 65.26 52.75 142.91 94.10 0.66 216691_at AL13770 6.99 2.59 4.47 6.99 13.48 8.88 0.66 212852_s_at 6738 TROVE AL53860 2410.62 2740.92 2451.15 2410.62 3727.41 2454.72 0.66 209598_at 10687 PNMA AB02069 62.45 98.10 105.80 62.45 128.01 84.35 0.66 209403_at 414060 TBC1D AL13686 356.98 312.13 314.68 356.98 546.19 359.92 0.66 214112_s_at 541578 CXorf4 AA54307 689.74 601.70 673.93 689.74 1073.97 708.60 0.66 CXorf4 OB

219500_at 23529 CLCF1 NM_0132 35.07 29.74 13.52 35.07 102.82 67.87 0.66 214372_x_at 10595 ERN2 A1732416 109.55 201.02 223.42 109.55 223.09 147.47 0.66 215614_at 644974 LOC64 AK02203 12.63 12.40 12.05 12.63 50.87 33.63 0.66 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 201602_s_at 4659 PPP1R1 NM_0024 215.44 287.20 298.78 215.44 388.08 256.86 0.66 214866_at 5329 PLAUR X74039 153.90 213.29 96.43 153.90 329.94 218.47 0.66 201409_s_at 5500 PPP1C W67887 546.52 512.06 671.00 546.52 836.89 555.22 0.66 B

204721_s_at 9829 DNAJC NM0147 4.28 3.77 4.86 4.28 14.26 9.47 0.66 222234_s_at 79007 DBND AK02264 6.22 12.23 19.51 6.22 43.98 29.19 0.66 202127_at 8899 PRPF4 AB01110 264.99 306.02 286.71 264.99 622.74 413.31 0.66 213221_s_at 23235 SNF1L AB01832 110.53 156.13 99.85 110.53 204.87 136.04 0.66 219194_at 57715 SEMA4 NM 0178 28.58 53.46 52.64 28.58 63.92 42.45 0.66 209593_s_at 27348 TOR1B AF31712 483.60 692.12 572.37 483.60 807.28 536.51 0.66 213704_at 5876 RABG AA12975 197.33 177.45 219.25 197.33 366.85 243.81 0.66 208989_s_at 22992 FBXL1 AF17922 162.99 267.67 236.95 162.99 299.12 199.08 0.67 214260_at 10920 COPS8 A1079287 69.54 97.49 105.14 69.54 119.44 79.52 0.67 214688_at 7091 TLE4 BF21730 41.94 49.52 47.01 41.94 66.86 44.53 0.67 215978_x_at 152719 LOC15 AK02151 1806.07 2790.17 3474.09 1806.07 2924.90 1949.14 0.67 204740_at 10256 CNKSR NM_0063 20.78 24.14 26.97 20.78 46.39 30.91 0.67 212761_at 6934 TCF7L A1703074 172.85 151.25 269.32 172.85 328.32 218.86 0.67 213128_s_at 7337 UBE3A AA52749 533.93 525.26 656.50 533.93 1469.59 979.70 0.67 202405_at 7073 TIAL1 BF43253 98.64 140.10 130.96 98.64 150.71 100.50 0.67 206836_at 6531 SLC6A NM_0010 32.57 47.75 67.11 32.57 65.59 43.80 0.67 204566_at 8493 PPM1D NM_0036 639.99 481.26 854.60 639.99 1094.05 730.95 0.67 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa TMAA TMAA Control LPS TMAA TMAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 213410_at 26098 CIOorfl AL05010 443.56 429.34 435.58 443.56 693.36 463.29 0.67 213229_at 23405 DICER BF59013 589.34 796.84 751.13 589.34 1257.70 840.42 0.67 202324_s_at 64746 ACBD3 NM_0227 1564.09 1347.60 1960.89 1564.09 2512.28 1680.94 0.67 201712_s_at 5903 RANBP NM_0062 264.00 289.96 271.50 264.00 431.95 289.25 0.67 205054_at 4703 NEB NM_0045 93.61 109.65 94.01 93.61 220.07 147.41 0.67 201038_s_at 8125 ANP32 T67821 568.73 749.56 643.22 568.73 941.00 630.35 0.67 A

218947_s_at 55149 PAPD1 NM_0181 285.78 249.08 237.07 285.78 490.12 328.33 0.67 212158 at 6383 SDC2 AL57732 784.59 589.45 861.24 784.59 1824.34 1222.69 0.67 217373_x_at 4193 MDM2 AJ276888 111.98 170.16 130.59 111.98 204.89 137.35 0.67 218566_s_at 26973 CHOR NM_0121 828.63 1258.04 1179.87 828.63 2132.94 1430.73 0.67 210837_s_at 5144 PDE4D AF01207 29.95 21.81 28.93 29.95 53.52 35.92 0.67 219363sat 51001 MTERF NM 0159 1244.05 1473.56 1572.44 1244.05 2732.43 1834.85 0.67 216273 at 10794 ZNF46 X78931 21.22 23.52 22.80 21.22 48.25 32.43 0.67 208200_at 3552 ILIA NM_0005 55.13 110.54 99.32 55.13 113.12 76.07 0.67 213810_s_at AW00713 72.66 71.00 135.01 72.66 124.79 83.95 0.67 201952 at 214 ALCA AA15672 2044.41 3613.90 3693.11 2044.41 6244.65 4201.66 0.67 201984_s_at 1956 EGFR NM_0052 24.71 35.65 15.96 24.71 56.33 37.91 0.67 218053_at 55660 PRPF40 NM_0178 3256.96 3735.16 3812.97 3256.96 5228.97 3518.93 0.67 210965_x_at 8621 CDC2L BC00127 78.95 110.34 108.81 78.95 123.86 83.37 0.67 221077_at 55130 ARMC NM_0180 34.21 60.53 49.11 34.21 60.89 40.99 0.67 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 218496_at 246243 RNASE BG53452 640.72 655.75 653.07 640.72 1224.76 824.85 0.67 222203_s_at 57665 RDH14 AK02362 430.76 452.66 377.55 430.76 713.33 480.74 0.67 216480_x_at 8028 MLLT1 AF06092 32.27 39.01 44.30 32.27 55.76 37.65 0.68 214024_s_at 85359 DGCR6 AA63115 3.04 13.54 12.89 3.04 26.19 17.69 0.68 50400_at 196743 PAOX A1743990 27.46 33.83 16.08 27.46 54.67 36.95 0.68 208581_x_at 4501 MT1X NM_0059 876.45 500.40 601.35 876.45 2203.33 1489.46 0.68 201496_x_at 4629 MYH11 NM_0228 10.07 9.74 10.26 10.07 33.15 22.42 0.68 217845_x_at 25994 HIGD1 NM_0140 1832.29 1853.31 1904.64 1832.29 3290.28 2225.17 0.68 210652_s_at 22996 Clorf34 BC00439 3.79 25.91 40.94 3.79 84.15 56.95 0.68 205737_at 3785 KCNQ2 NM_0045 17.68 32.00 27.10 17.68 27.84 18.85 0.68 46270 at 51271 UBAP1 AL03944 342.24 380.31 413.58 342.24 649.74 440.14 0.68 221649_s_at 56342 PPAN BO00053 312.43 366.94 234.87 312.43 675.36 457.55 0.68 203769_s_at 412 STS NM_0003 10.57 15.22 10.18 10.57 34.55 23.41 0.68 215134_at 55361 PI4KII H84390 26.18 29.67 36.22 26.18 52.67 35.71 0.68 218761_at 54778 RNF11 NM_0176 706.35 648.47 898.79 706.35 1126.75 763.98 0.68 219383_at 79899 FLJ142 NM_0248 15.95 20.81 9.16 15.95 25.82 17.51 0.68 215373_x_at 80047 FLJ121 AK02221 286.84 486.56 443.36 286.84 449.99 305.38 0.68 201889_at 10447 FAM3C NM_0148 676.05 797.67 690.68 676.05 1529.69 1038.27 0.68 213903_s_at 9125 RQCD1 A1380850 10.49 13.73 63.23 10.49 58.80 39.94 0.68 215877_at 89919 C14orf5 AK02444 7.32 9.83 6.32 7.32 15.64 10.62 0.68 200884 at 1152 CKB NM 0018 228.03 304.10 238.74 228.03 1445.47 982.33 0.68 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (10ng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (10ng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 218614_at 55196 C12orf3 NM_0181 804.52 1513.93 1308.08 804.52 3148.79 2140.21 0.68 211977_at 57720 GPR10 AK02465 217.94 269.29 272.32 217.94 386.14 262.55 0.68 202345sat 2171 /// FABP5 NM 0014 4523.51 3366.88 3513.20 4523.51 16384.06 11146.4 0.68 218708_at 29107 NXT1 NM_0132 778.31 1166.08 763.95 778.31 1400.02 952.50 0.68 216989_at 6677 SPAM1 L13779 13.11 19.24 28.62 13.11 28.25 19.22 0.68 221919_at 10076 PTPRU AW45092 251.98 301.98 195.53 251.98 400.23 272.58 0.68 212668_at 57154 SMUR A1654869 20.74 21.17 35.19 20.74 36.29 24.72 0.68 206693_at 3574 IL7 NM_0008 12.25 6.30 2.16 12.25 22.86 15.57 0.68 206139_at 5298 PIK4C NM_0026 213.39 239.42 201.75 213.39 425.61 290.40 0.68 205956_x_at 29893 PSMC3 NM_0132 316.31 400.51 344.65 316.31 495.96 338.41 0.68 213181sat 4337 MOCS1 AL58352 29.77 26.74 25.30 29.77 67.62 46.15 0.68 217063_x_at 6955 TRA@ X61079 2.72 9.23 18.29 2.72 23.34 15.93 0.68 215986_at 64430 C14orfl AU14699 19.83 18.51 47.63 19.83 53.83 36.75 0.68 33148_at 51663 ZFR A1459274 115.02 141.65 152.28 115.02 184.56 126.04 0.68 221677_s_at 29980 DONS AF23267 565.80 758.88 535.20 565.80 891.79 609.29 0.68 202076_at 329 BIRC2 NM_0011 1990.37 2073.34 2233.86 1990.37 3604.44 2463.37 0.68 200071_at 10285 SMND BF22425 908.25 733.38 1170.30 908.25 1573.19 1075.36 0.68 208424_s_at 57019 CIAPIN NM_0203 445.08 432.13 457.50 445.08 682.47 466.70 0.68 220344_at 56673 CIIorfl NM_0206 6.98 11.69 12.15 6.98 10.82 7.40 0.68 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 209568_s_at 23179 RGL1 AF18677 146.44 1099.56 1182.05 146.44 2480.91 1697.81 0.68 202388_at 5997 RGS2 NM_0029 446.40 463.76 501.12 446.40 839.25 574.37 0.68 219047_s_at 79759 ZNF66 NM_0247 101.56 111.58 135.23 101.56 180.00 123.19 0.68 219062_s_at 54877 ZCCHC BE67654 266.43 339.99 333.79 266.43 747.35 511.64 0.68 222239_s_at 26512 INTS6 AL11762 466.70 675.29 449.82 466.70 796.00 545.04 0.68 214056 at 4170 MCL1 BF98128 115.20 143.89 147.31 115.20 224.16 153.55 0.68 214985 at AF07057 4.89 8.75 7.84 4.89 13.75 9.42 0.69 204973_at 2705 GJB1 NM_0001 24.10 20.54 28.13 24.10 50.42 34.59 0.69 221639_x_at 3192 HNRP AF06884 10.18 49.40 46.67 10.18 42.15 28.97 0.69 222182sat 4848 CNOT2 BG10520 1543.44 1189.76 1716.16 1543.44 2422.67 1666.06 0.69 202228sat 27020 NPTN NM 0174 2921.44 3196.32 2764.11 2921.44 5025.08 3456.04 0.69 211966_at 1284 COL4A AA90903 81.19 106.34 79.25 81.19 182.30 125.38 0.69 217880_at NM_0012 615.00 638.24 1089.08 615.00 998.24 686.60 0.69 210346_s_at 57396 CLK4 AF21222 841.00 1016.99 925.71 841.00 1415.61 973.80 0.69 209004_s_at 26234 FBXLS AF14248 1612.23 2097.63 2522.88 1612.23 2599.68 1789.14 0.69 220308_at 25790 CCDC1 NM_0123 24.68 18.43 35.70 24.68 49.55 34.11 0.69 215888_at 23047 APRIN AK02688 179.53 309.06 287.54 179.53 358.20 246.99 0.69 202205_at 7408 VASP NM_0033 607.69 646.02 574.87 607.69 1055.66 728.22 0.69 222118_at 55839 CENPN AK02366 254.76 350.51 256.95 254.76 449.58 310.14 0.69 219092_s_at 64768 IPPK NM_0227 116.77 183.23 164.92 116.77 231.85 159.96 0.69 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 205039_s_at 10320 IKZF1 BG54050 962.44 752.19 433.36 962.44 2080.00 1436.83 0.69 211129_x_at 1896 EDA AF06119 19.57 12.86 17.66 19.57 32.45 22.41 0.69 200784_s_at 4035 LRP1 BF30475 9.51 13.00 17.38 9.51 15.26 10.55 0.69 206043_s_at 9914 ATP2C NM_0148 12.10 9.27 19.04 12.10 24.72 17.09 0.69 213225 at 5495 PPM1B AJ271832 140.21 161.08 170.43 140.21 242.34 167.59 0.69 213701_at 91298 C12orf2 AW29924 609.18 529.79 616.46 609.18 1011.04 699.53 0.69 203161_s_at 9025 RNF8 NM_0039 3.22 8.17 13.48 3.22 17.84 12.35 0.69 208091_s_at 81552 ECOP NM_0307 953.79 1353.88 1177.53 953.79 2878.56 1992.10 0.69 221743_at 10658 CUGBP AI472139 2387.50 2660.11 3511.98 2387.50 4046.64 2802.07 0.69 209958_s_at 27241 PTHB1 AF09577 18.21 51.40 44.45 18.21 39.14 27.10 0.69 215546_at 5711 PSMDS AK00106 7.82 7.01 7.63 7.82 12.89 8.93 0.69 204308_s_at 9895 KIAAO NM_0148 140.43 215.94 201.49 140.43 407.18 282.95 0.69 215763_at AL08007 9.50 4.29 3.63 9.50 29.38 20.42 0.70 208882_s_at 51366 EDD1 U69567 945.38 867.08 1068.37 945.38 1484.56 1032.01 0.70 217939_s_at 54812 AFTPH NM 0176 1520.47 1655.27 1558.81 1520.47 2550.11 1772.95 0.70 214308_s_at 3081 HGD AI478172 50.39 66.35 71.66 50.39 224.25 156.05 0.70 214901_at 7554 ZNF8 AI671579 99.90 127.90 116.70 99.90 190.94 132.89 0.70 215290_at 645323 LOC64 AI480014 8.32 4.20 11.61 8.32 15.01 10.45 0.70 221192xat 79157 ET NM 0243 119.53 210.87 172.13 119.53 204.14 142.17 0.70 206497 at 55744 C7orf44 NM 0182 32.91 51.29 47.19 32.91 57.14 39.80 0.70 207201_s_at 6580 SLC22 NM_0030 1.23 7.13 3.56 1.23 19.78 13.79 0.70 Al 57 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 205020_s_at 10124 ARL4A NM_0057 410.69 351.50 947.75 410.69 768.54 536.18 0.70 201837_s_at 9913 SUPT7 AF19795 710.81 903.90 958.65 710.81 1187.79 828.96 0.70 211449_at 2956 MSH6 D89646 10.46 13.90 6.52 10.46 27.64 19.30 0.70 202351_at 3685 ITGAV A1093579 900.06 1130.88 1112.19 900.06 2638.30 1842.00 0.70 212964_at 23119 HIC2 A1912206 458.21 356.89 498.96 458.21 718.97 502.28 0.70 219028_at 28996 HIPK2 NM_0227 84.90 111.34 76.49 84.90 186.97 130.77 0.70 209246_at 10061 ABCF2 AF26109 39.27 106.79 95.59 39.27 156.67 109.58 0.70 220117_at 79750 ZNF65 NM_0246 5.62 3.51 5.54 5.62 30.25 21.16 0.70 204831_at 1024 CDK8 R59697 358.00 394.44 498.47 358.00 652.13 456.51 0.70 218650_at 54487 DGCR8 NM_0227 465.67 567.09 506.57 465.67 709.52 497.41 0.70 200921_s_at 694 BTG1 NM_0017 1503.67 1492.57 2660.36 1503.67 12888.20 9037.04 0.70 202423_at 7994 MYST3 NM_0067 1695.24 1817.39 2043.63 1695.24 3022.12 2119.35 0.70 209838 at 9318 COPS2 AA49624 177.77 178.21 177.15 177.77 277.06 194.36 0.70 216737 at AK02452 1.92 14.72 13.93 1.92 10.46 7.34 0.70 219178_at 79691 QTRTD NM_0246 202.35 195.44 155.50 202.35 332.97 233.70 0.70 203693_s_at 1871 E2F3 NM_0019 382.28 471.34 584.57 382.28 989.90 694.99 0.70 214551_s_at 924 CD7 NM0061 5.34 7.67 3.32 5.34 18.78 13.19 0.70 212802_s_at 26130 GAPV AK02384 758.21 838.56 763.35 758.21 1151.03 808.51 0.70 220102_at 668 FOXL2 NM_0230 124.84 101.03 111.54 124.84 189.96 133.53 0.70 212170_at 10137 RBM12 BF44770 184.11 193.75 206.49 184.11 311.94 219.32 0.70 206096 at 7584 ZNF35 A1809774 134.20 164.65 138.85 134.20 240.65 169.40 0.70 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 221749_at 253943 YTHDF AU15791 1970.64 2080.51 2522.96 1970.64 3456.17 2434.35 0.70 221277_s_at 83480 PUS3 NM 0313 449.46 418.04 399.97 449.46 775.74 546.42 0.70 209639_s_at 6002 RGS12 AF03011 17.65 47.93 47.52 17.65 46.40 32.69 0.70 213168_at 6670 SP3 AU14500 1641.39 1383.59 2069.14 1641.39 2641.44 1861.45 0.70 211962_s_at 677 ZFP36L BG25031 93.53 182.47 272.65 93.53 384.50 271.07 0.70 216035xat 6934 TCF7L AV72143 77.97 95.55 113.77 77.97 133.66 94.25 0.71 202857_at 10330 TMEM NM0142 4091.43 4007.43 3615.54 4091.43 7501.73 5291.66 0.71 204934_s_at 3249 HPN NM_0021 28.10 35.60 32.97 28.10 56.85 40.10 0.71 212195_at 3572 IL6ST AL04926 877.45 1383.26 1757.03 877.45 1832.20 1292.85 0.71 205799_s_at 6519 SLC3A NM_0003 28.63 30.21 32.41 28.63 49.28 34.78 0.71 222168_at 220 ALDH1 AF19844 10.34 9.23 8.40 10.34 20.97 14.81 0.71 202512_s_at 9474 ATGS AK00189 223.75 207.22 164.81 223.75 339.40 239.64 0.71 217572_at AA65458 4.01 3.97 2.78 4.01 10.34 7.30 0.71 203444_s_at 9219 MTA2 NM0047 16.43 7.55 8.93 16.43 34.45 24.33 0.71 221356_x_at 22953 P2RX2 NM_0163 8.16 9.71 11.87 8.16 24.96 17.63 0.71 218242_s_at 51111 SUV42 AA05609 861.09 861.46 1109.93 861.09 1498.11 1058.86 0.71 221143_at 29935 RPA4 NM_0133 59.19 194.71 170.61 59.19 184.47 130.39 0.71 219735_s_at 29842 TFCP2 NM_0145 10.82 15.00 5.94 10.82 27.36 19.35 0.71 219782sat 51333 ZNF77 NM 0166 6.41 11.84 20.31 6.41 16.28 11.51 0.71 214235_at 1577 CYP3A X90579 22.16 26.09 8.78 22.16 34.79 24.64 0.71 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 219001_s_at 79269 WDR32 NM_0243 600.71 779.97 669.32 600.71 1071.57 759.37 0.71 202550_s_at 9217 VAPB AF16021 552.79 593.15 692.99 552.79 1074.42 761.54 0.71 203078_at 8453 CUL2 U83410 26.90 34.69 26.84 26.90 57.44 40.75 0.71 209654_at 23379 KIAAO BC00490 210.18 237.85 261.27 210.18 424.64 301.58 0.71 204656_at 6461 SHB AL13875 61.03 93.10 71.89 61.03 177.86 126.33 0.71 213682_at 10762 NUP50 AL03634 1702.89 2121.78 2154.63 1702.89 2858.81 2030.64 0.71 211936 at 3309 HSPAS AF21629 8112.84 12515.14 10649.28 8112.84 16578.74 11784.3 0.71 219738_s_at 5101 PCDH9 NM_0204 3.58 3.80 7.62 3.58 10.28 7.30 0.71 205579_at 3269 HRH1 NM_0008 56.44 85.32 137.67 56.44 1043.96 742.28 0.71 216583_x_at AC00407 108.06 145.46 131.13 108.06 180.75 128.54 0.71 208309sat 10892 MALT1 NM0067 114.35 157.84 144.03 114.35 235.70 167.71 0.71 203549_s_at 4023 LPL NM_0002 525.11 978.15 796.81 525.11 4603.58 3276.34 0.71 209323_at 5612 PRKRI AF08156 1265.89 1106.19 1227.42 1265.89 2034.55 1448.23 0.71 219361_s_at 64782 ISG20L NM_0227 151.18 137.02 81.90 151.18 613.16 436.66 0.71 36552_at 26005 DKFZP AL08022 231.70 255.33 285.84 231.70 364.63 259.93 0.71 214113_s_at 9939 RBM8 A1738479 1299.62 1551.86 1432.72 1299.62 2710.69 1933.28 0.71 A

201851_at 6455 SH3GL NM_0030 399.33 441.70 290.76 399.33 816.35 582.39 0.71 210018_x_at 10892 MALT1 AB02611 129.64 189.31 154.54 129.64 270.14 192.90 0.71 201910_at 10160 FARP1 BF21327 9.44 7.99 14.61 9.44 19.00 13.57 0.71 219522_at 24147 FJX1 NM 0143 36.44 37.15 34.57 36.44 250.00 178.70 0.71 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (10ng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (10ng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 91617_at 54487 DGCR8 A1028241 170.83 226.61 185.19 170.83 494.02 353.18 0.71 213262_at 26278 SACS A1932370 312.38 280.21 255.51 312.38 518.33 370.62 0.72 211326_x_at 3077 HFE AF15066 20.03 11.40 23.61 20.03 42.62 30.48 0.72 204229_at 57030 SLC17 H40895 33.62 46.71 54.86 33.62 81.09 57.98 0.72 221047_s_at 4139 MARK NM_0186 12.38 31.15 30.69 12.38 61.50 43.97 0.72 217494_s_at 11191 PTENP AF02313 8.49 4.41 5.65 8.49 15.21 10.88 0.72 201920_at 6574 SLC20 NM 0054 1024.95 1531.14 1552.34 1024.95 2201.60 1575.45 0.72 Al 15 214047_s_at 8930 MBD4 A1913365 1055.41 968.06 1488.41 1055.41 1818.60 1301.52 0.72 201713_s_at 5903 RANBP D42063 1466.56 1607.08 1524.59 1466.56 2371.08 1698.11 0.72 210917_at 7525 YES1 AF11991 5.23 16.96 16.60 5.23 16.98 12.16 0.72 219286_s_at 64783 RBM15 NM 0227 1471.49 1661.22 1642.61 1471.49 2490.75 1784.15 0.72 210054_at 79441 C4orf15 B000364 492.56 486.38 589.89 492.56 773.58 555.05 0.72 211775_x_at 84796 MGC13 B000613 8.06 4.13 4.33 8.06 14.79 10.61 0.72 222132_s_at 55750 MULK AJ278150 353.70 420.12 338.88 353.70 574.29 412.25 0.72 203282_at 2632 GBE1 NM_0001 2653.48 2221.58 2792.95 2653.48 4128.11 2964.30 0.72 212792_at 23333 DPY19 AB02068 311.57 616.44 484.75 311.57 649.02 466.12 0.72 219976_at 51361 HOOK NM_0158 12.46 4.87 15.96 12.46 18.78 13.49 0.72 201143_s_at 1965 EIF2S1 B000251 882.84 961.20 822.82 882.84 1622.30 1166.00 0.72 214815_at 51592 TRIM3 AU13658 69.95 123.66 162.19 69.95 138.11 99.33 0.72 211951_at 9221 NOLC1 A1355279 1100.14 881.10 909.25 1100.14 1895.54 1363.79 0.72 214039 sat 55353 LAPT T15777 3554.81 3718.56 3599.88 3554.81 5666.72 4079.12 0.72 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (10ng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (10ng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 217001_x_at 3111 HLA- M29335 12.98 29.41 32.98 12.98 30.75 22.14 0.72 DOA

214925_s_at 6709 SPTAN AK02648 31.00 47.45 38.05 31.00 65.36 47.06 0.72 221963_x_at 730051 LOC73 BE99996 303.85 286.02 286.26 303.85 497.31 358.30 0.72 218937_at 54925 ZNF43 NM0178 330.65 302.59 352.84 330.65 515.16 371.54 0.72 216673_at 50858 TTTY1 AF00099 18.16 10.80 20.74 18.16 34.83 25.12 0.72 206437_at 8698 EDG6 NM_0037 22.91 14.04 11.03 22.91 39.28 28.34 0.72 212377_s_at 4853 NOTC AU15849 1356.47 1934.58 1641.78 1356.47 2441.62 1761.72 0.72 215893_x_at 2262 GPC5 AF33978 13.62 32.77 25.52 13.62 24.25 17.51 0.72 200797_s_at 4170 MCL1 A1275690 4187.99 4593.08 5116.10 4187.99 7034.20 5078.87 0.72 202613_at 1503 CTPS NM 0019 4727.13 5077.70 3843.93 4727.13 7671.52 5542.36 0.72 217162_at 7258 TSPY1 M94893 5.65 6.68 6.95 5.65 22.86 16.52 0.72 213136_at 5771 PTPN2 A1828880 1015.49 1222.19 1430.00 1015.49 1976.07 1428.65 0.72 215344 at AL13732 14.82 18.68 39.41 14.82 40.00 28.92 0.72 211725_s_at 637 BID B000588 1031.27 2006.66 1877.88 1031.27 4296.30 3107.50 0.72 212154_at 6383 SDC2 A1380298 761.09 569.17 722.51 761.09 1237.27 895.70 0.72 221732_at 124583 CANT1 AK02616 784.24 872.51 784.81 784.24 1386.89 1004.36 0.72 213009_s_at 4591 TRIM3 AK02270 393.96 426.07 508.32 393.96 711.22 515.24 0.72 203804_s_at 51747 CROP NM_0061 1529.19 1398.67 1469.66 1529.19 2319.21 1680.83 0.72 214807_at A1278204 41.44 59.51 43.94 41.44 64.50 46.78 0.73 206131_at 1208 CLPS NM_0018 8.66 9.73 14.65 8.66 19.30 13.99 0.73 218732 at 51651 PTRH2 NM_0160 600.26 516.28 603.23 600.26 1051.28 762.69 0.73 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 206355_at 2774 GNAL NM 0020 2.18 23.95 25.49 2.18 21.05 15.27 0.73 204405_x_at 27292 DIMT1 NM_0144 1103.60 1057.30 1251.65 1103.60 1751.53 1272.07 0.73 216490xat 442175 LOC44 AL13326 33.36 38.68 48.87 33.36 67.58 49.14 0.73 204837_at 66036 MTMR AL08017 804.57 1018.62 1031.17 804.57 1419.60 1032.26 0.73 218428_s_at 51455 REV1 NM 0163 612.12 614.11 781.15 612.12 944.68 687.90 0.73 214379_at 660 BMX A1954458 10.38 34.44 33.99 10.38 30.97 22.56 0.73 213415_at 1193 CLIC2 A1768628 69.43 85.26 77.93 69.43 237.75 173.17 0.73 208212_s_at 238 ALK NM_0043 8.04 6.48 16.11 8.04 17.29 12.60 0.73 215776_at 3645 INSRR J05046 5.44 6.62 3.48 5.44 13.32 9.71 0.73 205352_at 5274 SERPI NM_0050 239.82 290.12 285.15 239.82 514.65 375.34 0.73 NIl 25 217106_x_at 27292 DIMT1 AF09107 1108.60 741.84 1180.24 1108.60 1709.37 1247.10 0.73 215114_at 26168 SENP3 AK00092 52.39 78.02 82.02 52.39 96.97 70.76 0.73 204601_at 9683 N4BP1 NM_0146 190.90 325.74 325.99 190.90 510.97 372.89 0.73 208901_s_at 7150 TOP1 J03250 2887.11 2813.70 2784.18 2887.11 5107.20 3728.25 0.73 210869_s_at 4162 MCAM M29277 5.06 11.12 12.03 5.06 17.53 12.80 0.73 210557_x_at 1435 CSF1 M76453 8.39 38.30 32.20 8.39 25.45 18.59 0.73 50221_at 7942 TFEB A1524138 406.72 626.55 588.76 406.72 1084.38 792.07 0.73 207513_s_at 7743 ZNF18 NM_0034 919.08 837.63 1302.04 919.08 1908.19 1394.27 0.73 219449_s_at 54968 TMEM BC00274 1845.91 1870.07 2171.13 1845.91 3162.08 2314.62 0.73 218578_at 79577 CDC73 NM0245 464.99 597.79 711.52 464.99 1145.89 839.74 0.73 207680_x_at 5077 PAX3 NM_0139 3.57 4.64 3.77 3.57 11.00 8.06 0.73 211111 at AB01690 20.65 16.42 4.45 20.65 45.93 33.68 0.73 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 203082_at 9790 BMS1L NM_0147 305.56 413.45 320.62 305.56 467.58 342.88 0.73 203743sat 6996 TDG NM0032 1324.87 1331.25 1322.57 1324.87 2469.34 1810.83 0.73 31846_at 29984 RHOD AW00373 156.72 372.47 357.99 156.72 350.43 257.00 0.73 214701_s_at 2335 FN1 AJ276395 20.32 25.69 34.88 20.32 38.80 28.58 0.74 208256_at 1943 EFNA2 NM_0014 10.68 5.10 16.23 10.68 26.39 19.44 0.74 215053_at 10847 SRCAP AK02380 14.98 12.91 40.94 14.98 39.03 28.76 0.74 217987_at 54529 ASNSD NM 0190 1197.44 1010.71 930.38 1197.44 1821.81 1342.78 0.74 213030_s_at 5362 PLXNA A1688418 22.80 15.54 30.87 22.80 39.11 28.83 0.74 216213_at 4750 NEK1 AF15511 10.93 6.14 17.00 10.93 22.05 16.26 0.74 201991_s_at 3799 KIFSB BF22322 1858.93 2197.39 2283.59 1858.93 2886.88 2130.15 0.74 208217_at 2570 GABR NM_0020 21.07 28.02 26.58 21.07 34.27 25.30 0.74 212185_x_at 4502 MT2A NM_0059 1296.38 1024.92 882.29 1296.38 4233.39 3131.46 0.74 212907_at 7779 SLC30 A1972416 1730.18 2175.51 4455.87 1730.18 3091.75 2287.08 0.74 Al 201144_s_at 1965 EIF2S1 NM 0040 2093.74 2177.70 2519.45 2093.74 3878.47 2869.31 0.74 204651_at 4899 NRF1 AW00302 288.61 297.04 357.99 288.61 440.23 326.21 0.74 33579 i at 8484 GALR3 Z97630 12.57 9.11 17.95 12.57 34.71 25.72 0.74 202981xat 6477 SIAHl NM 0030 551.81 654.49 1013.27 551.81 1156.91 857.74 0.74 214155_s_at 113251 LARP4 A1743740 117.96 107.11 117.80 117.96 216.79 160.83 0.74 203590_at 1783 DYNC1 NM_0061 765.19 1027.22 832.83 765.19 1271.94 943.71 0.74 205178_s_at 5930 RBBP6 NM_0069 723.44 845.08 639.59 723.44 1229.40 912.59 0.74 201506 at 7045 TGFBI NM 0003 5679.79 4780.41 5140.67 5679.79 8538.91 6345.51 0.74 EA 0732: 1 hr preincubation with test compounds, 4hr stimulation with LPS
(lug/ml) or TNFa (lOng/ml) in THP-1 monocyttic cells (Affymetrix Human Gene array U133A 2.0) Probe Set ID Locust Gene Seq Control TNFa THIAA THIAA Control LPS THIAA THIAA
ink Symbol Derived (DMSO) (lOng/ml) (10ug/ml) inhibition (DMSO) (lug / (l0ug) inhibition From +TNFa (Fraction of ml) + LPS (Fraction of TNFa LPS
stimulation) stimulation) 44146 at 26205 GMEB AA04518 535.44 484.37 540.33 535.44 873.18 648.95 0.74 204622xat 4929 NR4A2 NM0061 14.85 62.09 57.73 14.85 114.14 84.90 0.74 221799_at 54480 CSG1c AB03782 232.43 369.80 285.95 232.43 519.09 386.20 0.74 222103_at 466 ATF1 A1434345 293.91 162.30 316.61 293.91 533.76 397.77 0.75 213370_s_at 51460 SFMBT BF05729 269.51 323.18 281.04 269.51 453.99 338.46 0.75 204630_s_at 9527 GOSR1 NM_0048 1480.16 1820.33 2140.78 1480.16 3284.39 2449.91 0.75 216263_s_at AK02221 44.11 51.56 49.28 44.11 72.18 53.85 0.75 204977_at 1662 DDX10 NM_0043 676.61 609.50 708.35 676.61 1024.69 764.61 0.75 210953_at 9819 TSC22 AF20129 20.81 6.33 11.43 20.81 38.03 28.39 0.75 221549_at 83743 GRWD AF33780 231.45 257.01 210.61 231.45 452.18 337.65 0.75 213750_at AA92850 871.91 936.70 874.32 871.91 1862.02 1390.70 0.75 214712_at 445329 SULT1 AK02382 11.17 40.47 32.39 11.17 33.60 25.10 0.75 213596_at 837 CASP4 AL05039 77.77 133.92 129.03 77.77 174.35 130.31 0.75 202451_at 2965 GTF2H BC00036 958.24 1030.06 1421.25 958.24 1642.29 1230.38 0.75 201437_s_at 1977 EIF4E NM_0019 556.50 418.04 503.01 556.50 876.69 656.82 0.75 203529_at 5537 PPP6C NM_0162 2385.22 2315.48 2481.33 2385.22 3677.76 2756.60 0.75 212229_s_at 23014 FBXO2 AK00169 322.06 365.74 269.55 322.06 526.35 394.75 0.75 Example 3 Effect of Tetrahydro-Isoalpha Acid on Brachial Artery Flow Mediated Dilation [0094] The purpose of this study was to evaluate the effects on brachial artery endothelial responsiveness (a measure of cardiovascular risk) of oral tetrahydro-isoalpha acid administration (100 mg).

[0095] Brachial artery endothelial responsiveness was evaluated in three healthy subjects by measuring Flow Mediated Vasodilation using a Sonosite MicroMaxx ultrasound machine according to the procedures as outlined in Corretti ,MC., et al., Guidelines for the Ultrasound Assessment of Endothelial-Dependent Flow-Mediated Vasodilation of the Brachial Artery - A
Report of the International Brachial Artery Reactive Task Force. J. Am. Coll.
Cadiol. 2002; 39(2):
257-65. Briefly, ischemia was induced in the brachial artery using a blood pressure cuff inflated to 50 mm Hg above systolic pressure with baseline and post hyperemic flow rate measured by ultrasound. The tests were repeated between one and two hours following an oral dose of 1056 mg of tetrahydro-isoalpha acid.

[0096] Results: Subjects were noted to have a 40.2% increase in flow rate above that observed from baseline (calculated as the 100 x (ratio of hyperemic flow rate-baseline low rate /baseline flow rate)) prior to tetrahydro-isoalpha acid administration. A
63.3% increase in flow rate was observed from baseline (calculated as the 100 x (ratio of hyperemic flow rate- baseline low rate /baseline flow rate)) one to two hours after tetrahydro-isoalpha acid administration. This is an increase in flow rate relative to baseline of 57%. It was further noted that tetrahydro-isoalpha acid administration resulted in a 28.2% increase in peak post hyperemic flow rate as compared to the peak post hyperemic flow rate in the untreated individuals. The increase in flow rate may be attributed to an increase in vessel diameter insofar as blood pressure and heart rate remained relatively constant during the protocol.

Claims (12)

1. A method for improving a cardiovascular risk factor in a subject in need, the method comprising treating the subject with a therapeutically effective amount of a substituted 1,3-cyclopentadione compound wherein said amount modulates the expression of cardiovascular risk factor associated marker gene expression.

2. The method of Claim 1, wherein the substituted 1,3-cyclopentadione compound is selected from the group comprising (+)-(4R,5S)-3,4-dihydroxy-2-(3-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-1-one, (-)-(4S,5S)-3,4-dihydroxy-2-(3-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-1-one, (+)-(4R,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-(3-methylpropanoyl)cyclopent-2-en-1-one, (-)-(4S,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-(3-methylpropanoyl)cyclopent-2-en-1-one, (+)-(4R,5S)-3,4-dihydroxy-2-(2-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-1-one and (+)-(4R,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-petanoylcyclopent-2-en-1-one.

3. The method of Claim 1, wherein the cardiovascular risk associated marker gene is selected from the group consisting of TNF.alpha., MCP-1, VCAM-1, MMP-3, ICAM1 and SDF1.

4. The method of Claim 1, further comprising lifestyle modification or pharmaceutical treatment.

5. The method of Claim 1, wherein the lifestyle modification or pharmaceutical treatment is selected from the group consisting of blood pressure reduction, cholesterol level modulation, diabetes treatment, increased exercise, inflammation, obesity and weight reduction, prothrombotic factors treatment, reduction in serum homocysteine and lipoprotein (a), serum triglyceride reduction, smoking cessation, and stress reduction.

6. A method for promoting vascular elasticity in a subject in need, the method comprising treating the subject with a therapeutically effective amount of a substituted 1,3-cyclopentadione compound wherein said amount increases vascular elasticity or dilation.

7. The method of Claim 6, wherein the substituted 1,3-cyclopentadione compound is selected from the group comprising (+)-(4R,5S)-3,4-dihydroxy-2-(3-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-1-one, (-)-(4S,5S)-3,4-dihydroxy-2-(3-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-1-one, (+) (4R,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-(3-methylpropanoyl)cyclopent-2-en-1-one, (-)-(4S,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-(3-methylpropanoyl)cyclopent-2-en-1-one, (+)-(4R,5S)-3,4-dihydroxy-2-(2-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-1-one and (+)-(4R,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-petanoylcyclopent-2-en-1-one.

8. A composition promoting cardiovascular health in a subject in need, said composition comprising a therapeutically effective amount of a substituted 1,3-cyclopentadione compound wherein said amount (a) modulates the expression of cardiovascular risk associated marker gene expression; or (b) increases vascular elasticity or dilation.

9. The composition of Claim 8, wherein the substituted 1,3-cyclopentadione compound is selected from the group comprising (+)-(4R,5S)-3,4-dihydroxy-2-(3-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-1-one, (-)-(4S,5S)-3,4-dihydroxy-2-(3-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-1-one, (+) (4R,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-(3-methylpropanoyl)cyclopent-2-en-1-one, (-)-(4S,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-(3-methylpropanoyl)cyclopent-2-en-1-one, (+)-(4R,5S)-3,4-dihydroxy-2-(2-methylbutanoyl)-5-(3-methylbutyl)-4-(4-methylpentanoyl)cyclopent-2-en-1-one and (+)-(4R,5S)-3,4-dihydroxy-5-(3-methylbutyl)-4-(4-methylpentanoyl)-2-petanoylcyclopent-2-en-1-one.

10. The composition of Claim 8, wherein the composition further comprises a pharmaceutically acceptable excipient.

11. The composition of Claim 10. wherein the pharmaceutically acceptable excipient is selected from the group consisting of coatings, isotonic and absorption delaying agents, binders, adhesives, lubricants, disintergrants, coloring agents, flavoring agents, sweetening agents, absorbants, detergents, and emulsifying agents.

12. The composition of Claim 8, wherein the composition further comprises one or more members selected from the group consisting of antioxidants, vitamins, minerals, proteins, fats, and carbohydrates.